Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F54B11.2   

sjj_F54B11.2 RNAi JA:F54B11.2
Simmer:F54B11.2:Repeat_a
Simmer:F54B11.2:Repeat_b
Simmer:F54B11.2:Screen
PCR_productsjj_F54B11.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF54B11.2 Source_evidenceePCR714WS150 Sequence/Annotation Release
Overlaps_Gene (8)
Overlaps_transcriptF54B11.2 Source_evidenceePCR714WS150 Sequence/Annotation Release
WB_DNA_textsjj_F54B11.2768aatgaggttcacgaaatcacagtgaacagaactgcaagacaggctggatacacttcgggaggaggagccgacgctggtgctggtgcttcaagcggcggtcaatgtgaaggatgctgcaatccaggtccaccaggagttgctggtaaccctggaaagcctggaaaaccaggaaagccaggagcaccaggaaacccgggtgcaccaggaaaaggagcagctgttccatgcgaagccaagactccaccgccatgcaagccatgcccagcaggaccaccaggaccaccaggaccagacggaccagctggaccagcaggaccagacggagaagccggttcaccagccgcaccatccccaccaggaccaccaggaccatcaggacctgcagggcctgcaggaaacgacggagccgccggaactccaggaccagatgggccagctggagagagcacctatccagagccagcagcaccgggaccagccggaccaccaggacctgctggaccaccgggaccagatggagccagtccaaccgctgccccaggagctgccggaccaccaggaccaccaggaccagctggagctccaggaccagacggaaacccaggaacagcaggaccaccaggaaaagctggaggcgaaggagaaaagggaatctgccccaagtactgcgccatcgacggaggaatcttcttcgaggacggaacacggcgctaattccttattttttaacattaaatatttcgcaatcgactttttgtatgtcttgcc