Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F54C1.1   

sjj_F54C1.1RNAiJA:F54C1.1
PCR_productsjj_F54C1.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF54C1.1 Source_evidenceePCR954WS150 Sequence/Annotation Release
Overlaps_Gene F54C1.1 Source_evidenceePCR954WS150 Sequence/Annotation Release
Chunk_score Abs_score870
Max_abs_score870F54C1.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI50110465012710
Overlaps_transcriptF54C1.1 Source_evidenceePCR954WS150 Sequence/Annotation Release
WB_DNA_textsjj_F54C1.11665gaggtctggctcatttgctcaacgcctctgtcattcagttttcaaactggccactgtcagatggttacgtgacctccttgaatcttccagcctcgcctgcatctgtaccgaaaacgggtaagttctctctctctcatgtttcccaaattttgaagtaatttcaagtgttgttttgataacatttcaggtactcaccactcgagtaattcaatgagttttcttcaaagatgcaagaacgtattatttcatattgctatattggttacacgttttgttcaaatgaaaacacttgatacgatgttttcaaatagaaattatccatgggtaagtggttccttttgagggaaaactgtaaaaaggacaatattatctggtggaaaattgtctggaaaattaccatcaacaaaatgcagagacccgcttctgtaaaatctatgtgaaaattttgaaaaaaaaaatcctaagtgggggaagtaaaaaactgtactaattaaattaaaacaaatttacagatccaagttgaacttaacgaagcgcaacgtccattattcgcaagtcgtgctgaaatgattttcgaatcagtaagaccaatcaataatagaatcaaattctttggagctgcttctacaatgtaagttattatgtggtatttgttttaaaagaaatttattacaaaaaaaatattgaataaaattatccatgagcgaattttattgcaaggaaagtaatatatctcatttacgtatgaaaactatgtcatgtgaaaaaatgccttttgaataggcaattccaaaaaactttgcggtgctgaaaattggccaatctgcatcattatgaatgattgaaaattatttgcaaaaatgagagaaatactgaaaaaaaaattttttgagttgtgttaaaagaagaataattataaaaaagattcaacattccaaaaagtttctaattttcaaattgtccaaaacctgcagaaatccgcttttgtggcaactttggagatttctctggcacttattttttgtagttatctctctgtttggaggtcaggaaaaatatttgaaaaaatgtaactgaatttcagggctccagaaaactatatcagctcctcaaatcattttcaaatcccttctacagtttctttttcggaacctgtccttctcagcgccaacagtactaacctaacagccgaatgtaccacatgtcacaagttggaatctagacttcggagacgttcctatatgtttaatatggtaacagatcgaactgttatatataatagacaacgagaacttcgtgacaaatatccaacaatcgattgggatcgcgttcactcggaaaaattcgttcttgtgacatttggaagtgttgcacaagttgataaaattcatttcgaacttctccgatctcttctggagacttttgcaaaacaacccggacttattatctggcaatcaaatttaaatgctcaagaaattaaagaaattcacaatttaacagttccggaaaatgttatggtgagctcatgggtgccaataaaagaactattggctcatgataacattgaatttctaatttgtcatggaggtatcaatactgtcaatgaacttggattatttggagttccggttcttggagtaccattacaaggagaccaagcttcga