Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F54C1.3   

sjj_F54C1.3 RNAi JA:F54C1.3
Simmer:F54C1.3:Screen_A
Simmer:F54C1.3:Screen_B
PF:GL1_8C6
PCR_productsjj_F54C1.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F54C1.3a Source_evidenceePCR702WS150 Sequence/Annotation Release
F54C1.3b Source_evidenceePCR702WS150 Sequence/Annotation Release
Overlaps_Gene F54C1.3 Source_evidenceePCR702WS150 Sequence/Annotation Release
Chunk_score Abs_score597
Max_abs_score597F54C1.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI49995725001095
Overlaps_transcript F54C1.3b Source_evidenceePCR702WS150 Sequence/Annotation Release
F54C1.3a Source_evidenceePCR702WS150 Sequence/Annotation Release
WB_DNA_textsjj_F54C1.31524ggattctcatctcgctcgtctaatcttctcttcaaatactcataattatttcgatagaccggacatttcaaaattctctccatggcagccgcgatccagaaggacgacactaaaatctgggtgagaaattcgattttttctctttttttaattttgtttttatctggtttttgcacgaccgtaatcccgcacgcttattgtgttttccatcattttcagaatctccgtcgagccaggaacgagttgcgatgaggattgtggatcgcaatatgaagagttcgtttttgatccctaccacctgattttttgtttgaatatctaatttttaaatcactaagtttgctggattttttcccttacagaatttctaatttcgggtgcatttcttcttttttcttagttggctgtaattgataccttccaaatagcttgtcgtgatttttgaaaaccgtgaagctgcatttcagaatttttgagttaaaactggggggttttgtccaaaattacagaaggcaatctgcatacaccggatagaacttcaaaaaaaatcatctaaattttatagttaatcactcactacattggatattcgcggaacttcatgtttctatccaaccatagatcatctaactgttcttcaaaattgtttagaaaatataattacagtacaatcactctcaagcagttactccttggaacgaaaaagctatgcggaagacgtaagagacatttgacccgactcacttcaagatggccgtgtttttcagtcgatccgacgaaggtaattcttaaaaaactataatttcaaagcttaagtgcaattatttcagatcaattcatatttcaatgaaactggtgtcactttgctggaaaattcgtgttcctaccgtcctggaactcaacgaagcattccaataaaacctacccgagtgatcagagttagagaagaaactccagtttccgttccaattgaggttattacgattgaagatgattcagatgattcaccatgtttttctgcgagaaatcgagcaccaggtggaacacggaaatatggattagattttatacaatcttcgggtcatatgccatatattcgttatgtttatatgaacaggtaatttgatttaatgcaatccagtaaaaaaatatatgatttgcagagcaaatgacttagtgccccagctgaatggcgaagaaaatggaaaaatcgaaggtcttatggaagcatatccgatgaataatgctcacatgtattcagatattgagttcctgagaaaagaaaaagtaagaattgtttttaaaaaaaagacataaaagttgtaataattttcgcttttttcactaaaatcgaaaatggaattttttgtttcgatttactgatttttgcaaaaataaaacaaaactttaagatttttcttttttccgatatttcgaaaaaattgcataatttgttttctttttagaagcaatttgtatgtatttctgaaaaagcgaacaaaattgtttcctgaaggcgaaatc