Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F54C8.2   

sjj_F54C8.2 RNAi JA:F54C8.2
Simmer:F54C8.2
PCR_productsjj_F54C8.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF54C8.2 Source_evidenceePCR786WS150 Sequence/Annotation Release
Overlaps_Gene F54C8.2 Source_evidenceePCR786WS150 Sequence/Annotation Release
Chunk_score Abs_score681
Max_abs_score681F54C8.2
Specificity_index0.902
Rel_score1
Map_statusUnique_ePCRIII94337169434907
F58A4.3 Chunk_score Abs_score74
Specificity_index0.098
Rel_score0.109
Overlaps_transcriptF54C8.2 Source_evidenceePCR786WS150 Sequence/Annotation Release
WB_DNA_textsjj_F54C8.21192tttcaaagtgcgaaaatttgatttttcttccagaattttctaatttttgctgattttgtgactctcagattattttcaccggaaatatgttttgccattttcgtatttcaatggttctcctgccgccaatcgttccttatttaaactgcgttcgtttttattgcttctttaattccttttaaccttcaaacaaattgtcttaatttagcttcagttttttaaattttatattttaacaggataatcttcgaacaatggccgatgacggaccaattattgaggaaattgccgagaagaatgggagggtggcaaggatcatgcaacgtctccaacatgacacacaaaggtaattatttttgttttcgtgctacaaattaatgtatggtgtttcagagtcacttcagtgccgggcttcaacacaagcgccacaggatacgctgaccttatcgctcttctggatcagtataagaacgaccttgaggctgttggattcaacgacttagagcaagctcgaagaagagctccttctgtggatattacggttagtttcaaatttgtgtgagaaatttcaaacaacataatatttgtttcaggtcggcagtaattcaactaatcttgtcgattactcccacggccgtcatgatatgccctcacaccgtcgacacgatagctccgatgaagaaatcacggcagccaacagtcaccatcagtcaccaataaatgtggggaatcgtaatgacacggatggtacaaatggcagaaatggaagtagagctggttcatcgagctccgatcgcgtgcggatgatagccggaaggaacagaatctcgaaaacgagacgttatagaccgggccagaaggcattggaagagattcgcaaataccaagaatctgaagaccttctgattccaaaggtatatattttttactacattccacatttaaacaattccaaatttcaggctccgttcgcacgcctcgtccgcgaaattatgcagacttccactccattttcctcagaccttcgcattcgttctgacgccatcaatgctcttcaggaagcatcggaagcactgttggtccaaatgttcgatggttcatcactcatttccgcccattccaaacgtgccacactgacgactacagacgtgcagctttaccgccgtctttgccttccaaatctctgattaaa