Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F54C9.4   

sjj_F54C9.4RNAiJA:F54C9.4
PCR_productsjj_F54C9.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF54C9.4 Source_evidenceePCR797WS150 Sequence/Annotation Release
Overlaps_Gene (7)
Overlaps_transcriptF54C9.4 Source_evidenceePCR824WS150 Sequence/Annotation Release
WB_DNA_textsjj_F54C9.41007attcgcggatcaactcattcgtagccataatcaaaatttgaaatataagattttatttgaaattaaatcaaaataaaataatttagtgcttcttggctctagctgggcatgggcaatagttagcatctggtccaatagatccatcctttcctggcaatcctggttgtccattatcagcatcacgtcctggttgtccatctggtccctgtggtccttgtggtccttgctctccatcaactccagaatctccgttctttcctggttctccttgagatcctggccatcctggagttcctggttgtcctggaagtcctggtcctccaatagttccatcttgtccagttggtccttcagatccttcagttcctggctctccttgtggtccttgttctccagtgattccggcctctcctggagctccatcttctccacattgtcctgcagatccagatgctcctgggaatcctggctctccaatatctccgtctggtccagtttctcctggtggtccttgtgggcattgaatgcatcctcctggaagatgatgggtaacagccagagatactccagaagctccatcacgtcccttatctccagatggtccttgatctccacgtcctcctggaagtcctggtggtcctggtggtcctggtgggcatccttgagagttggcatcacaattacattgagatggataagcagaacgcttgttacggaaaacgctggcgaaagcggcactgcgggattcagaatcaagagatggcttggtgaatccaatcatacgattccatgcatcatcagacatcacctgaaaacagttttttataggcatatccagttgaatcctttcggagtccaagttgactataactcatagatttataaaaaactaatactttaaatataaatactaacaggtttatcataattaccaaccttcatgtcatggactccagttacaatttcttctctcatcgtgtcaatatcgacaacaatggaatgcatgg