Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F54C9.9   

sjj_F54C9.9 RNAi JA:F54C9.9
[cgc5655]:F54C9.9
Simmer:F54C9.9
PCR_productsjj_F54C9.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF54C9.9 Source_evidenceePCR1025WS150 Sequence/Annotation Release
Overlaps_Gene F54C9.9 Source_evidenceePCR1025WS150 Sequence/Annotation Release
Chunk_score Abs_score941
Max_abs_score941F54C9.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII85797938580975
Overlaps_transcriptF54C9.9 Source_evidenceePCR1025WS150 Sequence/Annotation Release
WB_DNA_textsjj_F54C9.91183cgaacgggaagaacgtaaaaagcgtgaaaaggcagagaagaaaaaagaattggcagagctgaaaaaaatgaaacgatctgaaattgagcagaaacttggaaaactacagaaagctgctggaatccatatcccattaactcttgatgagctgaacgctgactttgatcctaaggaatttgataaaaagatgcagtcaattttcaatgatgagtactatggagttgaggagaatattcaagagaatgaggacgaaaagccgattttcagtgatgtaagttaactgttttttgtctcctaccgtatccaactctctcatttccagatggaagacagtgattatgaggattatgacaatttagatgtagacgagttgaaaagagaagaacaagaagctgacgatgacgacgaagaagatgaggaaagtgttgatgatgaagatgagcaagaagtgccaaaatcgaaaaaatctgcaatgaaaaatggaaagttcgatatggtggctgccgcacaaaaagcaatgtcaaaggataaaaatggtaatattgtaatttcaagatattttttgtcttatcatctgttcttcctttccagatagtcgtcggaaatcgaaaaggaacgctttgaaagatgctcttgcaaggaagaaacctctgttcaatccgaaggaaaagacgtttgaggaatatttcaatgaatactatgctttggattatgaagatattattggtgatacaccaacaagattcaagtatcgagatgtcgagtcaaacgactttggattgagcactgatgaaattctggaagctgatgaacgtcaactgaacgcgtgggcatcattgaaaaaagttaccgcttatcgtacatcacaggaagagtttttcgaccggaaagcgtatcaaagaaaggctgaagatgttaacaaaaagaaacgaattctttcaatcgattttggagggaaaaaatcactgaaaagaaaaatggaagacgaacaaatggagaaggagatggccgagatgaatgatcaaaatgataacaccgaagaagatgctgaaaagaagaaaaagaagaagaagagaggaaagaagaaggttaaacttactgaggtttgtattaaactttgagtaactagttctaaaatattcatctgactttcagactgaaaatcccgaagaaaatatgacgg