Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F54D5.11   

sjj_F54D5.11 RNAi JA:F54D5.11
Simmer:F54D5.11
PCR_productsjj_F54D5.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF54D5.11 Source_evidenceePCR755WS150 Sequence/Annotation Release
Overlaps_Gene F54D5.11 Source_evidenceePCR755WS150 Sequence/Annotation Release
Chunk_score Abs_score671
Max_abs_score671F54D5.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1154063111542233
Overlaps_transcriptF54D5.11 Source_evidenceePCR755WS150 Sequence/Annotation Release
WB_DNA_textsjj_F54D5.111603taagaaaacaaacggctgggcagtgataagaaaaagagacagaagagatacaaatgatcatagttcattttatgtactgttaacagaagtgtgtaattaaaatcattcgtaatcctccaaaactccgtccatatgctcgttttgtactttttgattgaaccgtctcttcgcggcttttcttttcagtggagcctgcattcgaaccttcggcgtcagatccttcatcgcgtcgagacccttcttctggagatattcttcgattttcttctcatccaaatgatccacagacacgtgtctccacaaggctttgaaatcgtcttcgagctctgggaatgtgaattctttgtcattgtagaagacgactcgatcctttttcttattgacttgtgtcggaacaacgatcacttcagaggatacttgctggaaaaatttaatttaatatttcacaaaattgctccttttttatactttgattttttcagtttgacaaatttaaaaattctgatttttaatcaaaattaaccctaaataccctagtttttgaaaagttataatgagaatattctgccttcaaaaatgtttttcctttgaaaattttttaaggaaaaaggttttatgctggaaaagtgtaataatttttttttactttattaaatatattttttcaaaccttttttttatcgatttcaatgtttttttgtggaatatttaacttatgggatcgaaaatgatcaaaattattcgtgtaaaaattgaaaaataacgttaatttgttcaaaagtctgaaaataaagtaatttctgaattttattttataaattttcaacacattttatcttttttgtgaatttatatatttaattttcaatttatttcaatttgaaaatcaaaaaaaaacacattgttgaatactcagaaattctaaaagatctaattcatcacaaactcaaattttaattactacgaaaaataagccgctgataattttaaaatcaattttactaatttttagctgaaatttttgaaaaataaaaactttatttttgttataaattattcaaattcccacctgcagtagtgcatcataattagccacacactcagccaaatccgacacaagaattccaccttttccgtcctgataatgtttcctcgcgacagctaccaacgaagtttttcctttaattttgtaaggtggtcgaaatgcgaatttttcggattccattatcagtcgaggattgtttggtaatgcttcttgaaggaaagcaagacttctttttgaaagatcaaaaatttgaagttcatcgagaatttcttgaagtgtcaacggccattgttgattgtttaggtggcgtttctgcaattaactgtttttaactcgaaaatttcgctttaaaatataaataccttcatataatccacaattttcgccattgtactgaaatttgtggcatttgataacgcattggcgttgctcacggaattattgaaatctgggactgaaaattccgttttcagaaactaatattacattttaacaactaacgtttcgacaaattttgagccggtccagagcttttcttctttttcgcttttgctgctt