Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F54D8.3   

sjj_F54D8.3RNAiJA:F54D8.3
PCR_productsjj_F54D8.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F54D8.3 Source_evidenceePCR1052WS150 Sequence/Annotation Release
Chunk_score Abs_score989
Max_abs_score989F54D8.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII50793315080489
Overlaps_transcript (5)
WB_DNA_textsjj_F54D8.31159gggagtctgcggacagattattccatggaacttcccacttcttatgcaagcttggaaacttggaccagcgttggctatgggaaacacagtcgttatgaaggtcgccgaacagactccactttcagcccttcacgtggctgctctcacaaaagaagctggattcccagatggagtggttaatatcattccaggtcagttttgtaaaaattgtgagtttctcaaataaataaattccaggatacggacatactgccggacaagctatttcgtcgcacatggatgttgacaaagtcgcttttactggatcaactgaagttggaagacttgttatgaaggctgctgcagaatcgaatgtcaagaaggtcactttggaactcggaggaaaatcaccaaacatcattttcgctgacgctgatctcaatgattccgttcatcaagccaaccacggactcttcttcaatcaaggacagtgctgttgtgccggatccagaacatttgtcgaaggaaagatctatgatgatttcgtagctcgttccaaggaattggccgagaaggctgttatcggagatccatttgatttgaaaactactcaaggaccacaagttgacggaaagcaggttgagactattttaaaatatatcgctgctggaaagaaggatggagctcaattggtgactggaggagccaaacacggagatcaaggacactttgtgaagccaactatcttcgctaatgttaaggatcagatgactattgctcaagaagaaatctttggacctgttatgactatcattagattcgacacaatggaagaattagttgaaaaggctaataacactatttatggattggctgctggagttatgactaaggatattgataaggcacttcatattgccaacgcaaccagagctggatctgtctgggttaattgttacgatgtgttcgatgctgctgctccattcggaggattcaagcagtccggtaagctaatttattattaaaatttctccatgccaaagttaaaaaatactttttcttttaggaatcggtcgcgaactcggagaatatggtcttgaggcatacactgaagtaaagactgtcaccatcaaggttccacagaagaactcataaatttcttgaattttcgctttccctg