Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F54E12.1   

sjj_F54E12.1RNAiSimmer:F54E12.1
PCR_productsjj_F54E12.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF54E12.1 Source_evidenceePCR411WS150 Sequence/Annotation Release
Overlaps_Gene (8)
Overlaps_transcriptF54E12.1 Source_evidenceePCR411WS150 Sequence/Annotation Release
WB_DNA_textsjj_F54E12.1866gtttcgtatctgaatcctgcaactttcagtacatcagatacgattttcaagcagcgacacctcagtttatggatcctgaatgtgcctttcataaatttcataatactatttcaataataaattcataatactaatgtaatactaatttcataatactaatgtatagaggcgcattaaaacaaataagtattgggccgaaaccttttttataaatctgcgaacttctgacgaatttgtagttcggttctccgggccttcaaaatgatacaaaaaacaaataaagaaaacaattttattttacacaaggactggatttatgcatttgtggccctaaagagggccgttgggttcggttaagttttgagattaagcttgctcaactaccaaaaaaggtatttaagcgcgctctcctcggatgcgtctggccaattggatatcctttggcatgatggtgactcgcttagcgtggatggcacacaagttggtgtcctcgaagagtccgacaaggtaagcctcggcagcctcctgaagagccatgacagcggaagattggaatcgaagatcggtcttgaaatcctgagcaatctcacgaacaaggcgctggaatggtgctctgcggattagaagttcggttgatttctggtaacgtctgatctcacgaagagcgacggttcctgggcgataacgatgtggtttcttgactcctccggaagctggagccgatttgcgggcagctttggtggccaattgctttcttggagcctttcctccggtcgatttacgggcggtttgcttggtacgagccattgcgtttaggttgataatccgtggggactgtaaaaaagagaaaccaacgactgactttg