Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F54E12.4   

sjj_F54E12.4RNAiSimmer:F54E12.4
PCR_productsjj_F54E12.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS B0035.8 Source_evidenceePCR372WS150 Sequence/Annotation Release
F54E12.4 Source_evidenceePCR372WS150 Sequence/Annotation Release
Overlaps_Gene (6)
Overlaps_transcript B0035.8 Source_evidenceePCR411WS150 Sequence/Annotation Release
F54E12.4 Source_evidenceePCR372WS150 Sequence/Annotation Release
WB_DNA_text sjj_F54E12.4_1781cccctattaacctcggtacattcggaattttgtgtgcactcagtaatgtgtccccgcgggaagctccgcccctccaccgcagtttttacataaataggtgtctctccaaccatttcctcatacttgattcaagttcattctcatcatgccaccaaagccatctgccaagggagccaagaaggccgccaagaccgtcgttgccaagccaaaggacggaaagaagagacgtcatgcccgcaaggaatcgtactccgtctacatctaccgtgttctcaagcaagttcacccagacaccggagtctcctccaaggccatgtctatcatgaactccttcgtcaatgatgtattcgaacgcatcgcttcggaagcttcccgtcttgctcattacaacaaacgctcaacgatctcatcccgcgaaattcaaaccgctgtccgtttgattctcccaggagaacttgccaagcacgccgtgtctgagggaaccaaggccgtcaccaagtacacttccagcaagtaagccattaggctgaaaactaccccaccgaacccaacggccctctttagggccacaaatcttataatcctatgttattaaccaagtgaataaataattttcaattatactctttcataattttcaggttttgcattttccaagttcagttaatttgagattaacccagtattcattttctaaaagtcattctttcagagagagaaattcaaagcatcttcggaattctatctttcaaattgtagatgggattcttcgaatatttcc
sjj_F54E12.4_2781ggaaatattcgaagaatcccatctacaatttgaaagatagaattccgaagatgctttgaatttctctctctgaaagaatgacttttagaaaatgaatactgggttaatctcaaattaactgaacttggaaaatgcaaaacctgaaaattatgaaagagtataattgaaaattattcattcacttggttaataacataggattataagatttgtggccctaaagagggccgttgggttcggtggggtagttttcagcctaatggcttacttgctggaagtgtacttggtgacggccttggttccctcagacacggcgtgcttggcaagttctcctgggagaatcaaacggacagcggtttgaatttcgcgggatgagatcgttgagcgtttgttgtaatgagcaagacgggaagcttccgaagcgatgcgttcgaatacatcgttgacgaaggagttcatgatagacatggccttggaggagactccggtgtctgggtgaacttgcttgagaacacggtagatgtagacggagtacgattccttgcgggcatgacgtctcttctttccgtcctttggcttggcaacgacggtcttggcggccttcttggctcccttggcagatggctttggtggcatgatgagaatgaacttgaatcaagtatgaggaaatggttggagagacacctatttatgtaaaaactgcggtggaggggcggagcttcccgcggggacacattactgagtgcacacaaaattccgaatgtaccgaggttaatagggg