Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F54E2.3   

sjj_F54E2.3 RNAi JA:F54E2.3
Simmer:F54E2.3:Repeat_a
Simmer:F54E2.3:Screen
PCR_productsjj_F54E2.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F54E2.3a Source_evidenceePCR1183WS150 Sequence/Annotation Release
F54E2.3b Source_evidenceePCR1183WS150 Sequence/Annotation Release
F54E2.3c Source_evidenceePCR1183WS150 Sequence/Annotation Release
F54E2.3d Source_evidenceePCR1183WS150 Sequence/Annotation Release
Overlaps_Gene F54E2.3 Source_evidenceePCR1183WS150 Sequence/Annotation Release
Chunk_score Abs_score1162
Max_abs_score1162F54E2.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV27907242791906
Overlaps_transcript F54E2.3b Source_evidenceePCR1183WS150 Sequence/Annotation Release
F54E2.3a Source_evidenceePCR1183WS150 Sequence/Annotation Release
F54E2.3c Source_evidenceePCR1183WS150 Sequence/Annotation Release
F54E2.3d Source_evidenceePCR1183WS150 Sequence/Annotation Release
WB_DNA_textsjj_F54E2.31183cattgcttgccttgactgaatagacaccgctgtcttctggaacagtgtgagcaatgtccagtgagatgtatccgaagtcggtagtcaacttgaatcggttagagttcatcaatggctgaccatccttgaaccattggattctaaggtttggatccgtttgtggagtgaccttggtctggaagtgagctgattggaattccattctatcgatactgtcgagtggctcaataaattgtggagcatcatgctcagcatcaggcttctccggtgctgcagctcgtggtgcttcaagtacttgaatcttctgccaactttctgggtgttgagaatcggtgtagatagttccacgtggcaaaactgtgaagtttgcgatggtctgtgcctctccgagggagtttctggcaacacatgcccattctccagtatcctgcgcaaatgcgtacaagatgtcaagagcgacatatccgaaatcgtgacgagtacggaaacgatgtccattggcaagtggttgtccattgtggaaccattgtactgtgagctgattgtcgtttgttggctccacttgtgcttccaaatgaattggaactccttcttgaagctctccaagggaggaattgagctgagtgacgaactttggtgcagtcttttctggctcagcatccactgcctctagcttctcacggttttcaatttcttgaacacgcttccaggaagcatcatgcatggtatcaagaagaagtgattttcctgcggcacacttgactgtgcatgaggtggcagcttctccgaatgctgaaacagctttgcaagtgtagacacctgagtcttctccgtacaacgcaagaatgtccaagttgacataatcaaagtttcttgctggcatgaatcttgaagcttctggaagtggctgaccatttcttgtccaagtgactctcattgttggatcgttaactggaatcaagcggcactcgagacgaatcgattgtccttcttgagcatcttccttgtcagccaggttctcagtgaacgttggtggctggaatgtaagttccggcgttggttcacgctcatccacacggttctcgatttcttgaatcttctgccacgaagactcgtggtgagtgtcaagatagatgttgcgacgtggcttgcactccaagaagatgtcggtggtagcttcacc