Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F54H12.2   

sjj_F54H12.2RNAiJA:F54H12.2
PCR_productsjj_F54H12.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF54H12.2 Source_evidenceePCR904WS150 Sequence/Annotation Release
Overlaps_Gene F54H12.2 Source_evidenceePCR904WS150 Sequence/Annotation Release
Chunk_score Abs_score883
Max_abs_score883F54H12.2
Specificity_index0.715
Rel_score1
Map_statusUnique_ePCRIII79647777965680
Y57G11C.21 Chunk_score Abs_score128
Specificity_index0.104
Rel_score0.145
K09F6.5 Chunk_score Abs_score224
Specificity_index0.181
Rel_score0.254
Overlaps_transcriptF54H12.2 Source_evidenceePCR904WS150 Sequence/Annotation Release
WB_DNA_textsjj_F54H12.2904catcaactcccaactggcttatcataactcttcaaattatgcttacaaggcatatttcgaaaatgcactaatgtatggaaaagaaattaaaaactctactctcactgcagcaggatatttccacgaagatgaaattggcactccgacaagtaagggattccttaatcgttgtggtaccggaacaacgcaagttgccgcgaacatttctctcgatttgatgaaccaaccacgggttttgctaaattcgtgtaatgtgaaactgacggcatacccaaacaatagtgaatttttgattgaggcttacaatcatggtcaacaaaagttcaaattcaacgtcactgatgtttatgctcttgtcaatgagtttgatctaaccgatggattgtcaaacgagttggaggctgcaatcattgaacacaagatgattcagtacccaatgatttcctctcaagttcgcagcttttacattgatggagggcggtttgacgctcctgcaaatactctatttacaagtaaaatgccgagaagactctttctgggtctagtttcaagcgaagcttataacggatcgttcggaacaacaccgttcaatttcaaaccgtacggagtaacagacgtccacattgattattgtgggcaaacaatcccaggacgtccaatgaaccttgattttgaaaacaacaaatttgtggaagcctacgttcaacttcaggaaacacttggtcacactagaaacaactttagctgcaattcgatcgacattggaatgtttagatccaaaggatatacgatttttggattcgagttgagccctgtggctcaggataataatctgttcgaactagttcgtcaaacaaacgttagcgtacgcctcaatttcaaaaaggaaactccaccaggaggt