Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F54H5.3   

sjj_F54H5.3 RNAi (5)
PCR_productsjj_F54H5.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF54H5.3 Source_evidenceePCR775WS150 Sequence/Annotation Release
Overlaps_Gene F54H5.3 Source_evidenceePCR775WS150 Sequence/Annotation Release
Chunk_score Abs_score670
Max_abs_score670F54H5.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII66221656623345
Overlaps_transcriptF54H5.3 Source_evidenceePCR775WS150 Sequence/Annotation Release
WB_DNA_textsjj_F54H5.31181atcaagggacctggaggaacaacaaagccaattgctccaaaattgattactgtaagattttggataaagaagtttggaaatcaagtgaattatgtttcaggttaacccattgaatattattatcgagtctaattcaggacaaattgataaaactctggaactcaagtaagtggcgatttccagacgtgtatttgcaaatgtagaaatcgaacgagaaatgtgatacaatttcccgaaatgcgctcttgaaatgaatttaattggatgggtctcgccacgagaaaaattattgcaacgattttgatctttcggacttgtcatgaattattgttcatgaaatttaacaaaatcccagccaaggaaaaaagagcttcttcttctcgcgagactactttgagtttagaaaatctataatgtttcagaaacatctatccatgtcgtattgctttccgtgttcgaacaaatggaccgactagatacacagtttgccccagtaaaggattcttgagtaatggcgaaaaagtggcgattcaaatcacattgattgatggaacaaaatatcaatcaaatcatcagtttatcgttcaagcaatgccttctcccggagactttgctgatcggaagttcatctggaagcaaccaaattttcttggaatttttacaaatactcgtgttaagacaatgtgagatttttcggaaaatactcattaaaaatcatcttttaggagaccggctcaatctttgccgaaatcgaatccgaaaagtccagcaaaggtttcaaccccaacagactctggcatgtcctcgccggtagcttcatctgagtcattggtaactccgtctgttcctagttggtccaaatcaccgtcatctccaattgatcatggaaaatttgcggaaaacatcaatgatctgagtgttcaagtaaaaaaagcaattgatgagaagaatacacgtacgagtgaaatggtttcagttgtcaatcagattaaagcagttgaagtggatctagacaggcaggcccaattggtgaatgaattgagtgaaagagttaagagaggagaaattcaatactcggtatgtaaacgaactctttttcatttcagcaaaatccacaacttttcaatgttttcagaatcttgtgatgcatgaacgaagtctgagagttgagctgggtcgtc