Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F55A11.1   

sjj_F55A11.1RNAiJA:F55A11.1
PCR_productsjj_F55A11.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF55A11.1 Source_evidenceePCR561WS150 Sequence/Annotation Release
Overlaps_Gene F55A11.1 Source_evidenceePCR638WS150 Sequence/Annotation Release
Chunk_score Abs_score554
Max_abs_score554F55A11.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1176604311767084
Overlaps_transcriptF55A11.1 Source_evidenceePCR638WS150 Sequence/Annotation Release
WB_DNA_textsjj_F55A11.11042aacattgaaaactttggaaacgaggaattggaaattatggctattaattagatcgttgtcctaatcagaattctcgattattgtgtgccaccagctttctgcatttgttcctggtgagatcttgcttgatcttctcgaagcttttgtgctttgaggaactctccgtagtcgatgaagccatcagcattgaaatcgtcgtccctgaaaatattcagtaaagtatttttttaagactttgaatattttagtgctttcttatgctaattgctagcagtagtctctagaaaataaattaattaaatatatatctcactttaaaatactatcaatcatcgtctccaattcaacttcacttgggagtggtggtggctgatgattggcattggcattattttgtgtatgctgtggtcctggattctcggcatggaaatgcgttattgccttaatcaactcgactccatccagtttcccatttttatctaaatcgtgcatattgaaataatggaattgaagttgttctggcgtcatgttagcagttgggtccacttttccgtccaaatgttcttttatgtggctgaaatgttttaaattaattttgaaaattgttattaaaacttactgttcatctctggcctgttctccaccaaactgctgttgcccaggctgagcatgttgagcttgttccgcttggccaccctgatttattcaatacaatttacaaaattaaagaagctttaaaataataaaaatcactgtatccagattgtttttcagttcaatttctagcgaaaataattttcttattattctttacaaacattgtttacctgttgtggttgctgttgattagaaccaggaaactgctgtggttggtgggcaaaggaaccaagaatgaggcaagataccaccaaaatgttggctgccattcctgtaatattataatcactaaaatatagacaaaactaagtaagaatacagaaaacggaatcaaaaacggaagcgtgaagtggaagctgttattttatttgtgtcgatttacggg