Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F55A12.9   

sjj_F55A12.9RNAiJA:F55A12.9
PCR_productsjj_F55A12.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F55A12.9a Source_evidenceePCR991WS150 Sequence/Annotation Release
F55A12.9b Source_evidenceePCR991WS150 Sequence/Annotation Release
F55A12.9c Source_evidenceePCR991WS150 Sequence/Annotation Release
Overlaps_Gene F55A12.9 Source_evidenceePCR991WS150 Sequence/Annotation Release
Chunk_score Abs_score907
Max_abs_score907F55A12.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI53739775375135
Overlaps_transcript (8)
WB_DNA_textsjj_F55A12.91159attctcacctggaatgcgacacgatcaatcatgttcaacgacatattcctttcatgagccatcagacaaacagtactttcgtcaattactcgatacaaaagcatcaagaagtcgtatttagcctgtcctgtaaccaagagagaagatgtggtcgcttgagaagtagatgcttcagaatcagtatctgatccagatgaagaccattgatcgtaagtggctccgttaaatgatgttccaaagtgagaatccaagtagtttcggagcttattttcctgtgagattagatcagggaaatcgatgaagaagcgggagcacatgtatctgaaaaatacgttatttttcatcataaaatagattgaaactgttcaaaaagaaaactacaaacctctccaatttgcgacaattccatggcttcgctgctttgtatcctctaataatcaaatgacagtacttcaaaagtcctccaccacgaatttcttccggtttgacagtatcgattaatctctcatgaagatgagtcattgcttgttgaacatcaccgtacatgctctcaattgtgatctttttctgttcacactcgtccaactcattaagaagtggatccaaatgaatttggaatgaatcaaccgagaattcaaattgccgcctcattttgttcacaaacttcagctcaatgcaccgtccgtactcgttgttcagtgaaaacaacgaccatttatcattgtcagtggaaacctgaattaatttatagttattataaatattattactttccaaaaaataccttaatcattttccggatatagacatccttgagagtctcaaaatcgaatttctcctttccgatgttatcaggcattagttcacgaattgtcataaatacagaatcacgaatcgcatcgaaaatttgtttttcgacattttcatcggattcttcgtcaatttgaattgggaatatcaggtcgagatcagcatacgagaaatcatcagaagaggctacaaatgatgcggcgcctccgtttaggcgaacgtcacgggcttcaacttgaacacttctgaaattgaaatattttatatatggctaaaatcagaaactacttaccccatatgttgtcgtagacaccgaatcagattaatgagtttggtggagattgttggg