Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F55A3.2   

sjj_F55A3.2RNAiJA:F55A3.2
PCR_productsjj_F55A3.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF55A3.2 Source_evidenceePCR936WS150 Sequence/Annotation Release
Overlaps_Gene F55A3.2 Source_evidenceePCR936WS150 Sequence/Annotation Release
Chunk_score Abs_score915
Max_abs_score915F55A3.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1079433910795284
Overlaps_transcriptF55A3.2 Source_evidenceePCR936WS150 Sequence/Annotation Release
WB_DNA_textsjj_F55A3.2946aaatttccagatctccgcctaacacatcgtcgagattccgatgctgcaaactcgatgaaatggatatccacatttgatgaagatgacgtggttattcaacgaaaactctgtatgatatgtaagcagagtccgatggatgcttttttcaaatctcatgttgctcaagctcatccagctacaccatcggaagcatcagaagtgatgagaagactcagtgacgtcagatattcaagattttgtcaaaatggacaaatttcgaaggaatctattcaaaagatgttcccaacgatttcaccgattcttctgatcaattttcttgccggcttaggatttataatatgtcggaaagattataataagaaatctgtgaattttgagaagaaatatcagggatccgatgttcgtggtgtctcaaaatccgaagccaatgaaattctgaactctttaaaacagaattccattcgatttctggatgaacttgaattcagtgctgaaattgttacgaatgcaagaatgcttgatccttcaactcaatctacagttcaatgccatatttgtgataaaatttcgaatctgaagaatttcacgcgacacatgcaaattcatagggattccttggaaattttgggaatcaaatattcattggatgacgtcattgaaatatttaaaagaatcactgatgttcgaaatacgttgtactacgcagcacaaccaatatcacaatcaaaaatcatggaaatttgtgaaggaaatgtcgaagttcagaggaaacttgtttcttttcttcttgacgctggattcgtggtagcagacacttcgaaatatgaatcattggctcaaaagattattgtaatggatccggagatgccagaattgattgaagtgaaagaagaaccagaggattgcgatgagaaatatgaactaccgattctcgaagtgtcggagc