Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F55A3.3   

sjj_F55A3.3 RNAi JA:F55A3.3
Simmer:F55A3.3:Screen_A
Simmer:F55A3.3:Screen_B
PCR_productsjj_F55A3.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF55A3.3 Source_evidenceePCR1030WS150 Sequence/Annotation Release
Overlaps_Gene F55A3.3 Source_evidenceePCR1030WS150 Sequence/Annotation Release
Chunk_score Abs_score988
Max_abs_score988F55A3.3
Specificity_index0.874
Rel_score1
Map_statusUnique_ePCRI1079170710792888
F55A3.7 Chunk_score Abs_score142
Specificity_index0.126
Rel_score0.144
Overlaps_transcriptF55A3.3 Source_evidenceePCR1030WS150 Sequence/Annotation Release
WB_DNA_textsjj_F55A3.31182cgtttcgaaattatgccgtttcggatcagttttagtctatttaaacaaaaaaaatctaaaagctcaaaatttcctatttttatttcaatgattttccagatacacatctcttcgtggtgatcgtattgatgttctctacaacaacatcaaacatgcattcttccaaccgtgcgacaatgaaatgatcatccttctgcacttccatctcaagaatccagtattgtggggaaagaagaagtataaggatgttcaattctacacagaagtcggagaaatcactacggatcttggaaagtatcatcatatgcaagatcgtgatgatatgcagagtgaacagcaagaacgtgaaatgcgtcgtcgtctcaatgctgcatttaatagtttctgcgagaaggtgtctcgtctcacaaatgatcaatttgaattcgattctccgttcgctggactcggattctttggagttccgtatcgttcggctaccacactcaaaccaactgcatcgtgccttgttaatctcaccgaatgggtatgttttttgaattttattcctgaattcttttatattttatttattttcagcctacattcatcgtcacactctccgaagttgaacttgtccactttgaacgtgtctctcttcaactcaagaatttcgatatggtcttcatcttcaaagattacaagatcaaacctcagatggtcgcccaaatcccgatgagcagcatcgataagataaaagaatggcttcatacttgtgatatttggtacagtgaaggaattcaatcactgaattgggcaaaagttatgaagacaatcactgatgatcttgaagcattctttgaagaaggtggatggagtttccttaatgttgaatctgataatgaagaggcaatggatgattctgatgattcggatgcttatgatcctgaagaagaagatgcatctgctggatcaggaagtgaaagtgatgaagatgaaagtgaaggtgaagagactgaatccgatgatgatgatgaaggatcgttggattccgatgaatcagaaggaaaagattggtcagatttggaggaagaagcagcgaatgctgataagagacgtgaagtcgaagaaccttcacgtgatcgtgatcgtaagagaccacattcgagcaagtctggaccatcgcacaaacgcagaaagtaa