Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F55B12.8   

sjj_F55B12.8RNAiJA:F55B12.8
PCR_productsjj_F55B12.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F55B12.8 Chunk_score Abs_score601
Max_abs_score601F55B12.8
Specificity_index0.908
Rel_score1
C47A10.8 Chunk_score Abs_score61
Specificity_index0.092
Rel_score0.101
Overlaps_pseudogene F55B12.8 Source_evidenceePCR663WS150 Sequence/Annotation Release
Map_statusUnique_ePCRV1384383113844896
WB_DNA_textsjj_F55B12.81066tcaagccgtatgcaataccataatgtgtctgatatttttactttatgtctgcccaatgcaactgaggtttgttttgttcaagcattttagggaacaaatgtttataatttaaaacatttccgggttcaagttttcacagattttcattggatgtcacagtaagaatagaactatgactacattaattattgattgtttcctcattgcctatgctcctctaagttttggtcaaattcccataatctaattgaaaaaaaaaacaaaccagcaaaacatttttttctatgaaaacttatttcagcggtgcagacattctcgttcagtattcccatatactcggaggttccgcaatggcagcttatgaaatttctcatttatctcatcttctgactgctctcaatcgattttgtgttgtatttttcccattttattacaaaacactattttcgaaattgggaacaattgtaataattcatgcaatctgggtagtttctatattattttgtgttttgttttatgaaatacttggttgcttattcacctttgatgaagtatcatggacattcggatttctgacaactaaaaaatgcaatcagatgacctggtataccgatcttattttgaatactgcaatgataattataatattggtagtcaacctgctgacagctttcaaagcaggaaaaaacagtcgatctttgatgaatgctgccggtattaagatgtcaaagaaacaaaaacaacgagaacttggatttattaaacaaacatttcttcaaggaatatgtctttttgctggtcaattcacatattatctcattgctccattactctcagatactgtgctcttgtttcttctggtatcactttgggcttttaggaatgccgttgatgggcaagattggcctgaaggggcgtgcagagtcactggtgtttttgtagtataaactagaacattggattttaaaatcacagtaaaaagcgcttcattttaaaagatttttgcaattttgcaaaatgattaagatggaattttagagttttggtcagtttccgtcgggttatc