Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F55C5.4   

sjj_F55C5.4 RNAi JA:F55C5.4
Simmer:F55C5.4
PF:GL1_6E1
PCR_productsjj_F55C5.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF55C5.4 Source_evidenceePCR1044WS150 Sequence/Annotation Release
Overlaps_Gene F55C5.4 Source_evidenceePCR1044WS150 Sequence/Annotation Release
Chunk_score Abs_score981
Max_abs_score981F55C5.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1227505712276216
Overlaps_transcriptF55C5.4 Source_evidenceePCR1044WS150 Sequence/Annotation Release
WB_DNA_textsjj_F55C5.41160atggatgtctttaccgagcgctggacgctccaaattacattgtacagtcatcagctgcagaagtatttttcaatttttacccactaattggcgaggatactgaagacatggataggataatggaaaaccaacatcgatatatgatggacttattacgtagtgatgttatttccattcgaagcgaagccacgaaacatgtcttgaaggcaatcagcgaattctggcttcttattccaaaaaatatcgtgaaggaactcatgggatacatcattgatacagtcgcgaaagacactgttgtcagcgtccgcgtcgccgtttttgaaggtcttaatgaaatggcatttgttccggcatgtctcacagcattcgaatatggattgaaatgtgccgttgatccagcactacaggataaatctgaacgagttcgtcttgctgcttaccaaataatttctcgtctgaagaatcataaatttattaggtaaaatgaacccaaatcaacaaactaaaaaataaattttcagtgtgttcgatatcattactcgagatgatgccattgcgaaactcgatctggaaaacgtagagacctgccgccgtcaactgattccaattatgcatatttgtcttcctatctcgaaaagtctggatgaagcatactatcgtcctcgtgtcaactacatgttaggaaaaagtcgattggctcttttgagttacttccgattgcttggcccaatgaaaatcattgatgcatcccaagcatccaaacttatcgaaatgtttataacctgggcatatcgttatcttcgtaaaaaggatggccctccattaccagagactgccgaaggatacaaaaaagcgagagcttatcttgagtgtgctctcattctgtacatgtcatgcaaaggagttagttttctatttctcaaatttaaaattgaagaccttttttaaaacattataaacttctaaactttttcagatgctgatgtcagatggcgatggaacttcaaaagcgaaatgtgatcaaatatttggaaaagttgtcaaggaaatatttgaaaaatacgccaacactcctattctcggaactgcgacagcaatcagcagtgtcattcctaaagattaccttaaatcaattgctaatgatgttctcgcaagactgg