Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F55C7.3   

sjj_F55C7.3RNAiJA:F55C7.3
PCR_productsjj_F55C7.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F55C7.7a Source_evidenceePCR773WS150 Sequence/Annotation Release
F55C7.7c Source_evidenceePCR773WS150 Sequence/Annotation Release
Overlaps_Gene F55C7.7 Source_evidenceePCR773WS150 Sequence/Annotation Release
Chunk_score Abs_score647
Max_abs_score647F55C7.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI39993504000768
Overlaps_transcript F55C7.7a Source_evidenceePCR773WS150 Sequence/Annotation Release
F55C7.7c Source_evidenceePCR773WS150 Sequence/Annotation Release
WB_DNA_textsjj_F55C7.31419tcacatttccgttccatcaaaacagatacaaatacactgtgatggtgcactcctgacccgttgattatatgcaaaaactcggaatgaataactgtttcgagcaaaatttcgcagtgaaacatgtgttttctcaatgttcgtcgacgcgattagccaattttctggagatgagtcgtctaaaagtcaacaaagatttgagtggaaacttacaatcttgaaaatatcaaattgctacctacccaaaatacggtactcaatgcagtacttcaagcctgattccgctttccattttaggcgaacctcatgatcaccgcttattttcacggtaaaatcggttggaggatctgaaaatggaaactgtttagttgtttagttcttagattatttaaaaatttaaaaatattatttaaaaataaaagcatttctacctggaattgaaataacactgagaaatgcgacagtggacgtcactccaaatgagttttttgctattactgaataagcaccggcatcacacttttttacgtgtttaatcaaaagtcgactgttcagttgatttgtctgaaattaattctggagtcatttgaatgtctcaagaaattgaatacctggattctagctcgttttgagtcaaccgctggtccatgccatattacggtgaagtctgtatctgaaattaggaaaattgccactttcactttgtcaaatttattttaaggaattttttcgaagaaaaacttaataaaaaccgttccttgaaaaaattgcttgctatattttgaaaatattggacggaaattctataaaacgatttattttggtatgataatttaactttattaaattaaaaagatactttttgattgataaattggaaattttgaggtttttagaaaactctataaatcaattttttaatttaaaagtagaatcattgtgccaaaattaagatttgtaaattttttgaattttttaaaaccataactcacgcgaagaaataatcggacacatttcaacatcatttccctcgacaacttcaatatctttcatatcctcaaccacaactggtctctcacatgtcgtcaactccagaagaacgtcaaaattgtccgttgatgacgtggcagtatcaaatgcactaggaccgtattcaacgtccgtctcatccactctacgttgccattctcgacgatatctgaatcaaaggatttaacctttaataactaaaacctgtaattaagttcaaccgtattgtggaagttatcaagtggattattgccgaaatttatattaattttacgtatgaatccataacattctaatcttactgaatttgttccgcaaaatttgttcctggtatgtctgacattgtcaaaaagtagctgggacacttcccaacagtaccgtcggctttcttca