Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F55C7.4   

sjj_F55C7.4 RNAi JA:F55C7.4
Simmer:F55C7.4:Screen_A
Simmer:F55C7.4:Screen_B
PCR_productsjj_F55C7.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS (5)
Overlaps_Gene F55C7.7 Source_evidenceePCR1004WS150 Sequence/Annotation Release
Chunk_score Abs_score941
Max_abs_score941F55C7.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI40026914003873
Overlaps_transcript (5)
WB_DNA_textsjj_F55C7.41183gctcattttgcgattccattcgtccttctcctcttgtgattgtgcattcgcaatgaagcttgtcggctgtgttggatcggagctcttgatgacgaatcgaagcggatcatccggcacatttggctcgaacaccattttgtttacctgtaaatgttttttagattagtttatacattcgtcgtgattctatatgttttccttaccataaattgactcttaaaaatgtacgtgggatttccgaactccttcttcggcggaatgtgatctgcgatgatcgccgactgctcaaacaagaaaattcgtcgatctttcggtttttgtacgtttccggctatcgattcactgatctgcagtgttccctgatgaataagtttgccttgagctgagagacttttgtcaaagttttgcagacgaccgacttgcatcatgtcatcacaggcttttggaacaacatgcatcacctggaaaaaataggatttttattaaacaatttaattcaagatcaaaaattctcaaatgcagaattggcagccagctactactttaagttagtttttgaaaaacaagtacagaaatctcacctgtaacgctttcttaagcgtatcggtcttatcctttgctcgttcggtgaacttgagaatatccttgagcaacaattgatatttcatgattcgctgcaccggcttgataagcaagtcgcacagcgctaccttgtgtcctaattttgcttttgtgtctgcgaagaatgcctcaaaatcatcttgcgccaaaagatagtcggattttggcttgttttgacagtacgtcacgtacagagtgtgtaaccgtctctcgtacttgacaaacgcggctccggcggcttcgtaattctcggaacacttttcaatctctttcaggaagtttgttttgtggaactcaagaatattgactatattcgcgaaaatgattttgtcctttccgacgagatcagctggaagatccatcttgttcaaattcccaatatagccttcgacaaccgacgtcaagtctttcacataatcctgctcagtctcgacgagctccatcagcacatatgatctcttgaatcgagccgtctcttccggcgtcttctccacctttgcaggtaaagcgacttccggctcaacggcgtctgatgctgctaccgaatcctcgttcatgtcct