Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F55F8.2   

sjj_F55F8.2 RNAi JA:F55F8.2
Simmer:F55F8.2:Screen_A
Simmer:F55F8.2:Screen_B
PF:GL1_7F12
PCR_productsjj_F55F8.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F55F8.2a Source_evidenceePCR976WS150 Sequence/Annotation Release
F55F8.2b Source_evidenceePCR502WS150 Sequence/Annotation Release
Overlaps_Gene F55F8.2 Source_evidenceePCR1035WS150 Sequence/Annotation Release
Chunk_score Abs_score993
Max_abs_score993F55F8.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI56484985649625
Overlaps_transcript F55F8.2a Source_evidenceePCR976WS150 Sequence/Annotation Release
F55F8.2b Source_evidenceePCR1035WS150 Sequence/Annotation Release
WB_DNA_textsjj_F55F8.21128cggcaaaatatccttcctcaaccatccgatcagtttcgtccacaactaaacacttcaaatctttccattcagctaaaaactctccagtttcagcttcttgcatcatggcccacaatcgtccaggtgttgcaacgacaatatctggtctctgctgggaaataattctctcttgcttcacttgagccaatccaccaacaattgatgtggctattagttgagttgtggaaatgagagcattaatatgtttcatgatttgaatgacaagttcacgagttggagcaacaatcaatgcacgtggacctcgaacttctgtagattcagtttcttgtgaatcatctgacgattcgagtagacgtgcaaccaatggaattccaaatgccaatgtctttccacttccagtttcagcagcacctagaacatcttgtcgatcacgaacagcagcggggagcactgctgattgaatttcagtcggctcagaaaatctgaaaaaaaaaattaacattgtgaaaatctaaacaaattaatggtaaattgtgctcaccccatctgctcaatagcttcaagaacttcattaggaagaaaataaaattgtttccaagctgaaatatctgttttcttagatgcttcttttttggatttctttggttttcctgtatctccattctctcctccttttcttttcttctgctctttcggcttttcggtagtagtttctgtcgcattttcagattttttagcagaactctcagcttctttctgttttctttttgccaaccgttccttcttctgtttacgatttgcagccatttgttcttttcttctcaattttttggctagacgtcgctcctctacacacttcgcatcttcttctgggcgttcagtgttttcaacctttttcggtttgttctgaatatgaatgaatagttttagttaaaaaaaaaggagtcccaaatttattttagaactattcgtgaatataacatttttactataacttacctttttcttcattccttttttagtctcaacctcaacaccttccggaagaacttcttcaaaagatcccaagaattgaagcatgttatcatcgaagtcaccatccattgcttcaacatcacatgtctgcca