Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F55F8.4   

sjj_F55F8.4 RNAi JA:F55F8.4
Simmer:F55F8.4:Screen_A
Simmer:F55F8.4:Screen_B
PCR_productsjj_F55F8.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F55F8.4 Source_evidenceePCR1019WS150 Sequence/Annotation Release
Chunk_score Abs_score956
Max_abs_score956F55F8.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI56542565655449
Overlaps_transcript (3)
WB_DNA_textsjj_F55F8.41194gaatcatgacggccatttcttttttgttctggtgaatgtttacgaacacgctgactttccttccgaatcgacgatggacttcgccgtcttctcactggtgaatcctgacgttgtttgggtgaagatttccgatctcgtgagcttctcctctccggcgatttcaacccgatacttcttttggcgttcggagaatcatctcttcgagatctcttcctctctgacgatcttacttcgtttgacgattctgaatcattatgcgctctttttcggctcgaatcctttcttccatgggaattctcgtcttctgataaaacttcctgcttgatatacttcgatctgtattccggagaactttccacttctcttttgatccttttcgatgatttttctgaaacatgaactggttgaaaaatcgagaaactaataactactctaagcgtttcgttaatatttgatatcaatgaacaagtgtttaggatcaaattaattatgtaaaaacctcatctttaaatacctttccaatcatcctcactatcgctgccatcagaatcgtcatcagtttcacgagatttgctcttcttatttttcttcttatctttcttcttgtctttattcttccgtttctctttcttttccttcttcttctcttttttactcttcttcttcattacatcttccaaatctgcaccgctcatcagcttcttatgcaatttctttttttccttttcagtcatcgaattgaaaaactccagcatcatttcttcttcggtcatttcttttttcattcttgttagctgttgatctgtctgcattccagccaaaacagaacttttgagtttgattccatgttcttcacgcatatcactcgcaagttgctgatgatccatccactcatcctcatcgtcatcttctcctgtcgccgcagcagcagacgatttcgatgttgaaggtcctgctttgccttcctgtcgtctccgacgaagatctttgattaggtctgatggattatttgcatctgaaaattgattttacacatttaattcgattttttttcggaaacttacatccttcatcttcaaaatttccagattttccgaacaatggacattctcgatccgtatttatatgaccccatttgtggcatttacagcatcgaacatttctaacttgaattccgaatggttgatcttggat