Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_F55G1.11_b   

sjj_F55G1.11_bSequenceCACAGCTCGGTACATAAGGAATC
PCR_productsjj_F55G1.11