Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F55H12.1   

sjj_F55H12.1RNAiJA:F55H12.1
PCR_productsjj_F55H12.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF55H12.1 Source_evidenceePCR979WS150 Sequence/Annotation Release
Overlaps_Gene F55H12.1 Source_evidenceePCR979WS150 Sequence/Annotation Release
Chunk_score Abs_score896
Max_abs_score896F55H12.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI88736188874803
Overlaps_transcriptF55H12.1 Source_evidenceePCR979WS150 Sequence/Annotation Release
WB_DNA_textsjj_F55H12.11186tgcagctgttgtcttgatccgtggaatgaaagcaattggaaaactgtcctatgtgactgtgattctcccttacttcatcattgtcagcctactcatttgtggagttagcttgcctggtgcaaaagacggtctctatcacctgtttggacagacggatttcaattacttgtataagcgagaaacgtggactgctgcattgcaacaaatatgcttttccctttcaataggtcaaggtggattaatgaacattgcatcgtacaataagaagacatacaattggtacagggtgagggaataattattttcccatcctaaaaaaaagtttgcttcctaaaaaatgaaatttgcaggatgtctacataattgtgttcttggacactcttatgtccatactcggtggaataaccgttttctcgacacttgggttcttggcttatgaacgtggaattaattcaaccgacattgatgcattcaatcatattgttaaagaagggcatgctctcgcattcatcgtgtacacggaagcaatcgctgaaatgccagtgccgtatctttggtacgcgttgttcttcatcatgctcttccttttggggatcagtactgaagttggtgagttggagaaataggagaaatcgaatttgtaaaacatttgtaaacattcagtgattgttgaaattgtgtgctcctgcttggctgatcggttccgttatctccgtgaacgtagatggcttactgtattgtcagtctctgcggtatttttcttgcttggacttgtgatgacaactgatgtgagaaaagaaatagaattcatgaattaataaaactttccaatttcaggccggcttctactggttcgacatgtttgacgagtatagtacgggaatttcagcaacgtttgggactgcaatcatgtgtatgacagttttctggtgctacggaactaatcattttcgagaggacatcgccgttatgtggggagaaccggagagctggttggcaacatgtctgggacctgctgcatacttttggacgctgatttggaagtttgtaactccagtttgctcgctgttgatgatgggattgtggatttgggaaaagaaatatccacataagggagacggtaaaatctatccgccagtgtttgatgtgagcttatatattttatttttaatttggcgcgttatcc