Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F55H12.3   

sjj_F55H12.3RNAiJA:F55H12.3
PCR_productsjj_F55H12.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF55H12.3 Source_evidenceePCR891WS150 Sequence/Annotation Release
Overlaps_Gene F55H12.3 Source_evidenceePCR891WS150 Sequence/Annotation Release
Chunk_score Abs_score829
Max_abs_score829F55H12.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI88795828880745
Overlaps_transcriptF55H12.3 Source_evidenceePCR891WS150 Sequence/Annotation Release
WB_DNA_textsjj_F55H12.31164gaaaagatcaaaatgggcgaattgtagtgaattcaagaaatgccacgtcatcaataatgattttgtcttcgtcatttgtcctcactgcatcagacacagacacgagaaaaaccgaatttcaaatttattatcaagaagctggttagttatttctatccccattctcaataattttattatttcagatgcttctctttgcaatatatccgattcaaatcaattaattttcaattccgaatccatcccaatcccctgccattacactttcaaaactcaacatttcaattcatacatagcagttttagtacaaaaatgtgaaggactgaaccctgctacaattcaatacaacaactctaccgtaatccttcctccgagttctttcaaaaaattaatggttattcctgcaagttcattagacgtccatgttgacactacatggcctggtagtgaaactaaattagaaattcaatttttcgaactgaaacctggatctgaaagtgttgacgtgttcttgatagattctgatttggaaatagaatggatttcaaaatcaactgaaacttgtatggaaggagaatttcgaactttgacagttaacatgattatgacgtcatcttctaattctgctgcagaacatttcgaatcaacgtggaatgttcaggggtttcggaaaagttgcagcgaggacaatgttcaggtgaattttttattattattaggattatatctggaaacgtaaaaaatacattgaaaagtaaacgtatacattctgggctaacttttttaaaattgttactttttcagatagtgtcaaaaaaccagtcaacctatgtgacaaatttgggagttctcacaggatttggaccaactacagtggtaatacatcaatctgcagaaccatttgaatttcattcgatttataaaattaaccacaatgacgtcataacaacaactcctggaagaattttagatgaaagtgaaattgatcaggaacaaccaactactgatccaattataaccccgactacttcaagtcctaattgtgagttatttttgtgccttgttgtagtaaaaaatcatatagatgtggtacaaggatttgagcttaaaaatgtattgttagctgtggagattttgatttaaattgctccaaatgacccaaat