Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F55H2.4   

sjj_F55H2.4 RNAi JA:F55H2.4
Simmer:F55H2.4
PF:GL1_4D12
PCR_productsjj_F55H2.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene K08E7.3 Chunk_score Abs_score199
Specificity_index0.15
Rel_score0.177
F55H2.4 Chunk_score Abs_score1124
Max_abs_score1124F55H2.4
Specificity_index0.85
Rel_score1
Overlaps_pseudogene F55H2.4 Source_evidenceePCR1119WS150 Sequence/Annotation Release
Map_statusUnique_ePCRIII95048069505971
WB_DNA_textsjj_F55H2.41166agaggattggctactgcgaaagagacgttcagtggaagagccgctgtgggttttttgatgattgaaattccaaaaatgatcccaaacaaggttccggaacgagacaaaatgcagaagttcgtggagttcatggtggatatgaacgtgatttccgaagcatacccgaaaaaagaccagaaaagaaggccattcagtaatgcgagaatatatttattcatgaagactttggatgagttgaagaatcccaagccccgatctcgtcgatcagcgtctttcagtggtcctcgaaaaagcgcaaagtaagctgcataatcattttaaactgtgttataaaatatatttccagagttgctcaacctgcccctcctgccgcgacaatgcaccagccaccaaagtcaaggctccaacaagaagtttctgagaagaaggagaaggtttatgattggttaccgtttatcaaatcaagacgaaatcacacgaaagtcaatcaaccaacccgtcgttcaacatctcttgatcgaaatcatcgtgtactggaacaggaaaaagctgaaactgctcttcgtaaccagaaagtaaccactccgccaattcgagaagctccaaaagatgtggtcttcatgcatccacaaagaccattgcctgcagttcctagcagatatcaaaatcatcagacaaacatcgcaggatcaaatccagcattgttatcgcgtggaagaatgtacgaatccatcatgagaagatcgtcggttgttccagttgcagactctctccagccgaacaacgaatgctcattgtggaaaaaagagttgcttggacgattggaacagatttacgatcgcactcttccctgtgaatgggcgtctaaagtcgacggacacgatattcaatggaacatgcttgaaatagatcatgttgatggaatcgtcaaatcaagatgtcagggactgcagccagattatccggaaactgtcattcaattcatggattatcttgttcgctatccatttgtcacgtccaaaaaggcggatacaatgggggaatacaacgtcaatcggattttcataactctagtcaatcgtctcgaaaaaatttaatgctcctcttcaattcgatgaatgctctcttattgtgaatcttctctgcaaagtcgatagcttcgctgc