Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F56A3.4   

sjj_F56A3.4 RNAi (4)
PCR_productsjj_F56A3.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF56A3.4 Source_evidenceePCR1121WS150 Sequence/Annotation Release
Overlaps_Gene F56A3.4 Source_evidenceePCR1121WS150 Sequence/Annotation Release
Chunk_score Abs_score1079
Max_abs_score1079F56A3.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI51741535175320
Overlaps_transcriptF56A3.4 Source_evidenceePCR1121WS150 Sequence/Annotation Release
WB_DNA_textsjj_F56A3.41168ctttctctgggaagaatgcgcatcgatgttccgccagtctcatttccttgtccaatgctatcgacatcattagtcgcaataccagccatcagtcgactttgtcccagtgaaatgctaagatttccatcgcctccggtcaattgatcacaacgaatgcggagttctcgattttcagctctcaacacattcaattcaccgttcacctttcctatttggattttaagctcgtcggatgtctgaccaccaagcaacatggaagaagaatcaaatgtcgaatttttaaccatggttcgaatctcgtgctcaagcttgctacacttgttcatgtattcaacgagtgcctgacgagccttatcattttccttcttcgcatcagctaacttcgtttcaagatcatcaatgtaattgagctggtctcgcgtctgtgattcacgaccgttcccgatcatgaacgttgaatttggaaccatagcgtttccagcagctccgaggattccttgtccagtggccgcttcaagctgagcgcgaacattttctgaatcggcaagccttgcagattggtcgtcaagttcttgacggagctgctgaatgtgatcttccagctcagctaccttgtcgatctcagagaggagctttgcctccaggtcgttgatctttctttcttcataaccagaggttaatgtgaaatctggatcgtttttcttcagaatgtcatcaagagttccacgaaaagatccgacagttgtgttgtttgcatcagtagcggacaattccagttccttgattctttcctccattgcatgcttttgtgcctcaaattctttcatctgtctggcaaaattgtcttcggaagtttcaattctcgattgcattgctagcaaatcctcttccatcagtttgtattgctccattttctcttgaacattttcttggcctaatttgagatcgacataatcgtccataacttccttaactctcttctgcgacgcttcctttgcctcactataccggcgctgatacatttgcagttctccctacaaactcaaatcatttctaaataagcatatgataaattacttactctcaggatagttatttttgttttaagcgctttgttttcttcccatgtttggatgatggggatgctacgaacatcagcagacgaaaa