Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F56B3.4   

sjj_F56B3.4 RNAi JA:F56B3.4
Simmer:F56B3.4:Repeat_a
Simmer:F56B3.4:Screen
PCR_productsjj_F56B3.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F56B3.12 Source_evidenceePCR471WS150 Sequence/Annotation Release
F56B3.4a Source_evidenceePCR1034WS150 Sequence/Annotation Release
F56B3.4b Source_evidenceePCR1034WS150 Sequence/Annotation Release
Overlaps_Gene F56B3.12 Source_evidenceePCR471WS150 Sequence/Annotation Release
Chunk_score Abs_score471
Specificity_index0.326
Rel_score0.484
Map_statusBottom50_percentile_ePCRIV793179795222
F56B3.4 Source_evidenceePCR1036WS150 Sequence/Annotation Release
Chunk_score Abs_score973
Max_abs_score973F56B3.4
Specificity_index0.674
Rel_score1
Map_statusBest_ePCRIV793179795222
Overlaps_transcript F56B3.4b Source_evidenceePCR1036WS150 Sequence/Annotation Release
F56B3.12 Source_evidenceePCR471WS150 Sequence/Annotation Release
F56B3.4a Source_evidenceePCR1036WS150 Sequence/Annotation Release
WB_DNA_textsjj_F56B3.42044gtacgcaagcacaatttaccttcccgcagaggtttccggtcgtaatttgcagttatcgaagagttttacggcgtttttttgctgtcgagagaccaaatttcggccgaatttcgcggttagatccagttgaacagcgtcctgaaatttctcagattttccatttttcacggaaaaaaaatttaagccgaaaatttcaaaaatgtcaattattttccagaaaacctataatttttcagaaaaaaatcgataattttcaaattttaccgtcgccagtcgattatatttctcctgatcctctcgatttccatattcttccaaaacttccaactcattcatcatttcctccacaacttttgtaggcggagcttgagccggtggctccggagcacctttttgctcattttccggctctttttgctgccgagaagccttgaatttgctgatttttttgggctttttttgagtttcctccgaggctttatttcctcgatttttcaaaaattccagcaatttcggatcgaatctctcggtaatttccagcttcatttcttgaattttctcaaaatccagagatttcaaatatttctcgttttcagcttgaaaatcgtcacttcccgatggattttcagtggtttcctgcttaaaatccagattttccgccaaatttccattgatccggtcgaattccgcggcgaaaaagctctttccgcctaaattcgtcagagtttttggattttccgccgaaaaatacgcagaaagatccagcggctcggggaatccgtcatctttcgagtataattggaatttctgaagattttccgccaaaatctccgatctttccgcgaaatttcgctctttaactgggaaaagcacgccggaagcggcctgctcctcatcaaaatcgatttgaaaacgggcggcctgatcgcggacgactttcgacggcaatgaagcaacttcctcgactttctgccgatttttcatcttatgaatctcgacactcggttttttgttcgccgcctcccattcttcctgcattttgagcagatcatcgtcggtttccgtcgccgtaggacgttttacgtgttctgacatttctgaaaatctaaattttatcgatttcttacgaaaaaatgctgaaaaacacccgtttttatcgatttttccattacaatcggtaaaaaacctgatatttcaaaagtttgcgcgtcaagtctgtcgccgggtacgcagacacaccatcacgtcagattgcacattttgagaaagaattcttcaaaaatggggaattttcgattaaaaatcgctatcatgtctataaaaattggaagttttcacgattctaacgtaaaattactggaaaatctaaatctcaacgatttttcgataaaaaaaaattcaaaaataacaccgaaacactggatcggacttagtatgagctgaagaatattttaaaatagaacttttattgacgcaatgaaattttaacgatatacagcactaaatagaaaaaaatcttttgcaataagaccggctttatgtgaaattgaataaatttgaaatggaaaatcgatcaatctgcccaagtatcagtggatgtagacggctgctggcacggctcaggaagttggaaaatttctcgcatttcctcggcgcttttcccattgatacgactggcgactgtttgggttccataattcacgagtccggtaatatccaaatcataggcagctttaataacagctagcaagtttcccatcggcagtacactgaaaaaatgttgatcccaggacggaatgacgactttctttttgcctttttcggcttttgcaatctctggatcgtctcccttgtgttgatcacaccatttaatcagtagatccaatgtgtattcatgttcatcaacaggtatcggcttaatctccgcacagtcttctttatcatatcctagctctttgatagttgtagaaatagtgctggagagctggagagcacggatatctgcctgcagcacctctccattggaagaagccagttgaagtag