Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F56F4.2   

sjj_F56F4.2RNAiJA:F56F4.2
PCR_productsjj_F56F4.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF56F4.2 Source_evidenceePCR773WS150 Sequence/Annotation Release
Overlaps_Gene F56F4.2 Source_evidenceePCR773WS150 Sequence/Annotation Release
Chunk_score Abs_score710
Max_abs_score710F56F4.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI61462176147376
Overlaps_transcriptF56F4.2 Source_evidenceePCR773WS150 Sequence/Annotation Release
WB_DNA_textsjj_F56F4.21160atccaggtggtcaattccaaatatacggataccaatttcagttcgtagcgattgatgcagctgtttgggtttaccatgaatgtttctatgacgtcggtattcatcacggtttgtgtaaaagcaaaatggagatggatgttccagcggaattcaggaattatgagaaatacccgaaaaaagtatttaatgcaggaactatcgatttggagaatggagtacaaaatccccaattggaaaaaagtaaattaaaccgtgaaaattaaaatttgagtcacgaattttactgtaacacctcctctctcttcctcctctatctttattacaatttcatcaacatgaaagtaagttttttctctttgaagtcacctacagaagtatttttaaaggtatttttcttaatctttgccgtgtgtatcctgtcagtttgtgctgataaaaagtccattcgcatcactggacggatgatgtgtcgtggacaaccagcacaatatgtacaacttcaaatcctaacaaagaggcttttcactggtcaatatactttgatgaaaatgcttcataaaattgaaatgttttcaggtaatgctatcatggctgaaaatgtgttcactgatccaaatggttactttgacattgctggatacgttgatcaatcttctggtgttcgaggtcgtttttgggtttggcatgaatgtttttctcaaaagtatcataaggatccgtgcaaaaattggtttgggctgaacattcctgatgagttcgtaaccggcgctgcattgcccagagctgtatggccacttggagaagttgatttagaagatgagcagaaaaaagagtacttggataaatgtaaatgaatattttttattgaaataaataatttgttccatttgaaagaataaaagctacagtttttctgggaaatgagattatgcgaatttatgaatcatataattccaggcgcttccaatgccccacaaaatataacagttgacaaaataataaaagcttgcccttgaagtttgtatgcattctcatattctagaacacttccactgccattttaccattctcaaacaagaaagtttctgagagctcttgaaactcaaaattttacttggaatttttttaatgttaaaaatatctcaaaactgggcgtttct