Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F56F4.3   

sjj_F56F4.3RNAiJA:F56F4.3
PCR_productsjj_F56F4.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF56F4.3 Source_evidenceePCR657WS150 Sequence/Annotation Release
Overlaps_Gene F56F4.3 Source_evidenceePCR784WS150 Sequence/Annotation Release
Chunk_score Abs_score679
Max_abs_score679F56F4.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI61413836142453
Overlaps_transcriptF56F4.3 Source_evidenceePCR784WS150 Sequence/Annotation Release
WB_DNA_textsjj_F56F4.31071gtagttaaccgcgtaatggtgagaaacgatctcttattttcgaaacttagtttttgaagttatagattcgaaaaagattgattagcactccagaagatcctaaagtgaaaaaagaaaatgatacgaaggagaattcaccggagaaaaagctacttcaagaagaaatcgagtataatattgtgtatggatatgaccggaaaaagaagaaaaagagaatggattctacggaaagttcgtcagaaaatccagatggaattgagaaatttgataatgatgaggagctggcgattagtccaactggaaatccaaacttaaatccgagcaaggtataaaatcagatattattgagctattctcaagttctatttcagattgaagccgaagagctggaacaggaaatcggctcccgtaacatatcccgtccgagtacctaccgtcaactgtctcttcttctaagctgtgtgacacttttgaagaataatatggttttcattgaatgcttttttaatcatggcggaggtaaagcttcaaagtttatttaaatctcaatttaagttctttcagtatatttcttcgttccatatttcattattctgtttgttttgggagttcccatggctatatttgaactatctttagcacaattctcttcaattccaatgaatggaatgttcactcgaatggctccaatgttgggaggttagttatagaattaaagctattaatgccacgtaacagaataaaaatttgaaattccaggaatcccatggttaattctctgtcttcgtatcatctacactgtatatattgcatttgatcctcgctttttactatatgcgtacaaaagctttgttaccgtaatcacaggcaatatgaattggattcactgtgatgattataaaggtgtacggtgctttgatccaacatggtcatgcaagattaatgagtttcgtttgaatggggaatgtgttaaggatgtgcatattagaaagctagctcagtaagttcaaggttataatgaactcataagtacctgtattgtgtttcaggcaacaagattatggactcttg