Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F56H6.10   

sjj_F56H6.10RNAiJA:F56H6.10
PCR_productsjj_F56H6.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF56H6.9 Source_evidenceePCR863WS150 Sequence/Annotation Release
Overlaps_Gene F56H6.9 Source_evidenceePCR863WS150 Sequence/Annotation Release
Chunk_score Abs_score779
Max_abs_score779F56H6.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1230489112306035
Overlaps_transcriptF56H6.9 Source_evidenceePCR863WS150 Sequence/Annotation Release
WB_DNA_textsjj_F56H6.101145cacttatccggactgaccgtatccttcgtttccaccaacgcagttcaattcagaaatgcccacgactatctaaaagactttaaaaatgagaagcaagtttatgaagattcaggaaaaatgatagagttcctacataattggaattgcaccaggaataactcaacagttttggaaaactgtataaatcaacttttggtggacctggctaaagaaaagttatggggttccgaagatgcacgactcatggggatgtacttggaagatttgaaatctatggggtaagggaattcatgaggctttgtgaaatgaaaaactgaaaaatttagattcaaattccccaagctcgtcggaaacagtactcaagattactctgcgtcaagagatgaaacaactcgagatgtaaactgtagacggatgcatctagaatttgatttgctcaagccaagagaggaccaaagtattcgaagagcggaacaaaagctgaactatttcgggaatatcgtggattggtgcaatgaaaccggatattcaggttggtgcttcatttctgataacatatacataagccatcgcattcagacatatccataaatttcccatcacctaagcagcttgcaaaacagaacaacgaatcgtatgttttccaaaaggatttgaacagtgtaagtgaaacattattattgatttgaaaaatctgaagtcactgctggcagattgcgataagttagcaactaaagatattttccttggtctccgagctttctgaaaccaagattttttgtacgaatcagattttcagagtgtgtatctataaatattgtcccggaaactagtgagttcaatttttaggtactccttgcggtcaacaactacccctgggattacggtatggggctcatacaacgcctttaccaaccttactttgccacaattatattctgtgggtcctggtacccggaaaactttcaaaacttggataaaaccacctcaattatgcaccccatcaactatattcatatgaaccctgccgaaatgtcaaaaggtgcattcgcctatcactgtgtcactcttgttaaggaacttcgtctgaacaatgtgcaagggtactttctgatgtcagacgatgcagtcttcaacatctggca