Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F56H6.11   

sjj_F56H6.11RNAiJA:F56H6.11
PCR_productsjj_F56H6.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF56H6.11 Source_evidenceePCR1344WS150 Sequence/Annotation Release
Overlaps_Gene F56H6.11 Source_evidenceePCR1344WS150 Sequence/Annotation Release
Chunk_score Abs_score1155
Max_abs_score1155F56H6.11
Specificity_index0.847
Rel_score1
Map_statusUnique_ePCRI1230746512309646
F56H6.12 Chunk_score Abs_score209
Specificity_index0.153
Rel_score0.181
Overlaps_transcriptF56H6.11 Source_evidenceePCR1344WS150 Sequence/Annotation Release
WB_DNA_textsjj_F56H6.112182cagtgtttatcagctgtgcagtctatttagagaagcaatactttctccgagctgtgtactccctaaaaatcatttctcaggaattttaaatcccctattttattttgggctaattgaaaatgtgtcttggctttgaagcttcatttcccagatccgaaatgtcagataaggacgaaaagatctctcgcttttccattttgatccgcactatcctttctctcccgcagaagtcctctaaatctattttcagtacaatgacaaaacgagctgatttacaaggaattcgtggcttggctatacttgttgtactgggtttccatttttatccggacacctttccgaatggatatcttggagttgatcagtatgtttctaaatcaggaatttctacacaatcctgaacttttttcagattcttcgtactatccggatttctaatgtgcatgttgctcaagcgtgccgagacccacccatttttcacgttgttatgcacattttacacgaggaggctgaaaaggatcctgccactgtacttccttgtgattttaatctctgccatttgcctctacaacttttttcccgaaactgcaatcgagacaaataaagagtcggcaaaccgagcattggtattcatgtcaaacaggccaaaaaccgagcaggaagactatttccaaatggtgagctccaagtcatgaattacctaaaacaaattttgatttcagctttccatcgccattgatattttcactcatacctggtcactttccgtagaagtgcagttctacctaattgttcccttcatatttctgatggcatccaaatttgaaaaacttaaatatcctatttatggattactaggttagtttaattgaatgagttcagatatatatgaagcatgtttttatatgaagcatgttttttaggtatcctctcattcgggtactttgccctctcaccggctaatgtggcattcaacagtgtgctagcaagaatttggcagtttttgataggtaaaaattgttcacttataaatagagctgttatggaaacgttccttgtttccttggtaacgtcggaaagtacccccagaacttgaagggaagtctgcccaaacagtcctttttatgaattcagaaaatatcaacaaaaaaaagtaggctagctttcacggatgtttaaaaagtgcaacacttaaccaaaaactgtttttttttaaatttataatgatggatcttctaaaaacatcctgttcttctaaaaacatccgtaaaagctataaaacattgttgattttcaggaatgcttgtctatcttgtgtcttctaatgaacatgaattgctgagcaccaaatctagaaataaagaaagttatgaagaaacttacaaattattgatagaaactaacacggacgagccgaaagctcatataacaagttacttcaaaatatccgcttatatcttattggcatcgttgatagccattacagcttctccatttgtaccacctgccaccattacaaggttagcaaggttttccccctgccgtcattaaagttgatgtttcagactcactgctaccgtcggaactggattactgatgcttctctctgagaataacccattattatcaaataaggtgttaacctacattggagacatttcatattcactttatctagttcactggccaatttatgcttactggaagctcacgtgcaatgacgatcagttttgtaagctatttaatttcagtcagaactgaaacttgactttgaatatttccagtgctagttgctgctttggctgcctctatcgcgttagccataataatattcgaaactttcgagaagtggtatttgaagatttccacttcaagtctaggaattcttgtgatggtcttgctgctctcaaacctagcactaatcaacaaggatcatatgttcagtccaccaagcctctccgttaacacaaccaacatgacaatcgacgacgcaatacaatgtaatcgtgattggtctgtaaatgagcagcagctcttctacttcccattatgccaatacactgctctcggtgatcttttgggcatctgtaagtattcacaggtgggcactgagttgatttctcttgtaaactttgtaaactaggatctgccaaaagacggctacaaaatgattctgattggc