Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F56H6.7   

sjj_F56H6.7RNAiJA:F56H6.7
PCR_productsjj_F56H6.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF56H6.7 Source_evidenceePCR864WS150 Sequence/Annotation Release
Overlaps_Gene F56H6.7 Source_evidenceePCR864WS150 Sequence/Annotation Release
Chunk_score Abs_score738
Max_abs_score738F56H6.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1229975512300927
Overlaps_transcriptF56H6.7 Source_evidenceePCR864WS150 Sequence/Annotation Release
WB_DNA_textsjj_F56H6.71173ggtatgggattgatccaacgcctttatcaaccatactttgccacaatcatattctgtggatcctggtacccggaaaactatctaaacttggataacaccacctctgttatgcaccccgtcaactatattcatatgaaccccgccgaaatgtcaaaaggtgtattcgcctatcactgtgtcactcttgtcaaggaacttcatctgagcaatgttcaggggtactttttgatgtccgatgatacagtcttcaatatctggcagcgaatcgactactcgagagttcatcacttacacggctcgactaacttttataacagttggtctccaactgaatatggtaggatttgttttatttcaaagtgctgaaattttattttaggaatacaagccgccaaaaaaataatagaaaccgtgaaagcatctactgatccaaaagttctcacgacttggaaaaaatttgacaatggcctgaagcaatttgcatatcacaatattacggatggtggagaggcccaactttcgagcactcatggaaaaagtatttcggatttgtgagtaacttttcgactgtataagctttttaacttgaagcttcagctactacataccttcaactgaaatcgactactatgcggacctaatgagaatcttctacgacggcggactatttttggagaccgctgtaaaccgattcttaagatccgttgatcatcaaacgtaggctttatcccggaatatttacagaaaactgaaacgaatcctttcaggtccctcgccggatcatccagctacctttgggatgacaatcgggctcggtggcctaaattctacaataaggatcttgtaggcttgcatcctattaagccaagcaagtttggatatccaggagaagaacgaaaagcgtaggtgttgaggaagtgtttcgaaaaaaaaacaccgaaaatgtttcagatactgcgccacagtcatccaaacatggtctgacattgtgttcggaggatcgagaaacttcacagtcaaagatgatactgccaaagagaattataattgaaaaatgtatatttgaatgaatttagtgtcttttttgttgatgttacacaggaaatacaagatctatagattctaaaaggacattcaaaggaagactgtagtcgaggttcacagctagctcgg