Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F56H6.8   

sjj_F56H6.8 RNAi JA:F56H6.8
Simmer:F56H6.8:Repeat_b
Simmer:F56H6.8:Screen_A
Simmer:F56H6.8:Screen_B
PCR_productsjj_F56H6.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF56H6.8 Source_evidenceePCR752WS150 Sequence/Annotation Release
Overlaps_Gene F56H6.8 Source_evidenceePCR752WS150 Sequence/Annotation Release
Chunk_score Abs_score712
Max_abs_score712F56H6.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1230128612302311
Overlaps_transcriptF56H6.8 Source_evidenceePCR752WS150 Sequence/Annotation Release
WB_DNA_textsjj_F56H6.81026ctgtaccggactattttgaaacggtttgctccgaaattgaacaatggaaacccggtttgacattatttctgatggctaatgattattgtagagaaagatccattttattccaaaagcaatacacagttaatacacaatcgatgaaaaacctgcgttgaatccactttggttgccaaacccatctgatttgaatgtgacaaccatggtgctaccacttgatgtccttgtaaattcatacatgttaccgctgtaacgccccaaaattggactttcggttgacggaccatcgtaaattgtgacataatcatttcctgtgtcgaaaaatgtgaattttaaagctatcttgtaaggccccagtgtagcaagctgataagtacagttcaccgatccagaaagattgcgagagttgatgacaccaggagccatttgaattccaacattgcagtttgatggaatttcagggaatggaatagctgttgttgaggtcatggagcactgcacaccagctcttcgtttgcaaatgtattgcttagtaatactacaatctgcgctgtaccacgaaccagtcgagtgagctcctccactttttgtagccattgctgtgcaataatcaacacggttcgagttcaagaggtctatgttagtgtattgcatatcagtaccatcaatccatttaaggatattataaaagttccatgtagcaccaatgaaataatcaactactggagctattgtattaatatatcggttttcgttttcggaatggatggacacaaggtttccgccttctttttggcatgattcctgtgctttgagaggcactttggcatactggctgattgtgtaacagaatccgttatagttatgggtgcagttgtctggaataaatacatcttttattgtgaacgtttacatttccgtgtgggtctcgccacgaatagcttcacataagtgttaatttgatgtagaaaataaagtttgtgaaatttcaaattctaaaatgcagagaaaaggcattgaaatgac