Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F56H6.9   

sjj_F56H6.9RNAiJA:F56H6.9
PCR_productsjj_F56H6.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF56H6.9 Source_evidenceePCR566WS150 Sequence/Annotation Release
Overlaps_Gene F56H6.9 Source_evidenceePCR566WS150 Sequence/Annotation Release
Chunk_score Abs_score440
Max_abs_score440F56H6.9
Specificity_index0.853
Rel_score1
Map_statusUnique_ePCRI1230331112304345
E03H4.4 Chunk_score Abs_score76
Specificity_index0.147
Rel_score0.173
Overlaps_transcriptF56H6.9 Source_evidenceePCR566WS150 Sequence/Annotation Release
WB_DNA_textsjj_F56H6.91035aacggtttttgcaagacaatctagattttctaaacactcaaactttaccactttaggagtttattcatcagagaatttcttaaccgtttcgaatatcccaaagcatcaagaaattcatggtaacctaccatacaactgttatctttcaatttcaatagaaaaaaatcattaattgaataatgaaaaacgataggaatctcgaaacacccctatggctagcggctagtgatgtctcctgcattttgttcagttcactctattatatccgtttttccaatggccaagcttttcattagaaacgtattcctactacccttaatcgtaatattatccataagcttctttatttacaagtttcacaataacagtgctctaatttcccaactagtctccaaagcagtcttccatcgagaattcggtgaattcccaccattgaaaaaaggcaatcgatggattgtggtgacaagtgtcagtcagccaactgaggatgttaaggtagttttttttttaatatttaagatcaataaatcttggaaaaaaacttcagagacttgctgcaattgaagactggaatctggtagtagtggcggataccaagaccccgctagattggaagctcgaaaatgtgcacttcttatcagttgcctatcagaagcagctacgtgagttttggtatggcttgatgggagttcatcatattcaaattttcagcattcaccctggtcagtgaactcccttacaaatcctacacccggaaaaacattggatatctctacgcgatctcaaagggtgctgaatggatttatgatactgatgatgataataagccttatgataagttgatcataaaaattttgggtgaataagaaagttttaaggctgggactgaaacagtttgattatgaagatcaggtgtccggggtacggttcctcccgcagaacgcatcgggtataaggtttgtggctcttaaatttacgtataactacgtaaaattttccatattctagccaacgactctttaatccttaccggtt