Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F57B10.10   

sjj_F57B10.10 RNAi JA:F57B10.10
Simmer:F57B10.10:Screen_A
Simmer:F57B10.10:Screen_B
PCR_productsjj_F57B10.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F57B10.10 Source_evidenceePCR449WS150 Sequence/Annotation Release
Chunk_score Abs_score407
Max_abs_score407F57B10.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI65535116554528
Overlaps_transcript F57B10.10.1 Source_evidenceePCR449WS150 Sequence/Annotation Release
F57B10.10.2 Source_evidenceePCR446WS150 Sequence/Annotation Release
WB_DNA_textsjj_F57B10.101018tgtaacacagcaagagaaacgaaaccccaggtggcattttgcaacacaaataaattaatggaaggaattgaaacaaataaatacatattaaagcttttcagagtttatcccaagaagttgacgacgacaagatggagaatgaggtttgcgaagatgaaatcagcaaatgcacgttctgtcgagacagctgtgaactcggagcggttctcttgatttacttgcatcctgagacacgctaaaacaaaatattaacgtttagaattaattgcttaaaaatacatttatttattatcaattcatttgagggctgaagcgggggcccattggaatttccaatgtttatgatacgatgtgaaaattgcagtccatccgaaactcaaatgaacatacaatttatatttactttatttcgcttaagtaccaaacattttaaatcagcgcaaatctattaagaaacccagaaaccctttttaggaaaacaaagatcaccgttttaaccttttattactgaaaacaatactcatgttgccaatatacttgaacccaaattttttgaataaacaactcacatgctaaaacgaacgaagtgacagtggagatgaaaccagagaggaacgagttgaatgggaatgtaccgacgagcaagcaataaatgaattgaaagattccggtgaacaggatgtatgtcatgtaagcatcaatgattttcagcttcgatgatgttgtcttttggtagtcatcgaacagtttcgagagaactggaactacttgagccgccattctgtaattaatttaatatctttgagatacaacagaacaataagataaaatatattagaaaggagcgaaaaaacataaattttgaattagaaaatgcaacctagttatcttgaaacatgttcatgaaaaaataaaatttaaagcattcagacttttatttttgctagtataataaaagagaaatgtctttcatgacctgtatttaacgaatataaatgtcccgcaaagtataaatcct