Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F57B10.12   

sjj_F57B10.12 RNAi (3)
PCR_productsjj_F57B10.12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF57B10.12 Source_evidenceePCR843WS150 Sequence/Annotation Release
Overlaps_Gene F57B10.12 Source_evidenceePCR894WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRI65648206565987
Overlaps_transcriptF57B10.12 Source_evidenceePCR894WS150 Sequence/Annotation Release
WB_DNA_textsjj_F57B10.121168ggtgataaccatcggttgaataataagtatgcaattatttacaagaaaattacttatggctggaaacttttttcaatcgctcgagaatggcatcgagtttgtaaattgtctcctggtcaatctgtttgtagattttgtcccgatttttaactattttgcgaaaattgtgaatgcactctgttgcttttgcagctcgctcttcagctaccacatcgactccaattcgccgagttttggtggatgcaaatccgatgattgtgtccagtaaactgttggtaattgatgcaagagccttcaagcaagccgatcgcttcccataattgtcgctcgtgatattttctgaattacaaaacattagaataaatttatcaggaagcaaaaccaacccatgataaatgttaaacaagcatggcacgagttgagacaccaagagtttctactattcagaattctaatgactgtgggagcgagttggttgtcgtttgacaatatctgttccatgttacttgtgaaactcttcatcttataaacacgaagatctgaaaagaaaacataaactgaaaaatcaaaactctgcaaatcctacttctgctctctcgcttcgcacaaacaccgattttattcacttcctcggtgcatgcggaccacaacgacgcgtttgatgacatgactgacacggatgattctggggaggattttggcaaagaactgctatgttcttcacctctcgaaaccgggttccgagacaattccttcttcgactcggaatgcaatggacgtcttgagcgagtatttgtgaactcgggcagatcggctttcacagttcgagaactcccgatgaaagtgatgggaacgtccttttccgcaccgcgtctgaaaaaaatataatcgcttcagatacttttttcgtagaactcaccgactcgaagtagatcttgtatttggtctgttttcagcggatttcggaatgtcgttgagaggcttcctattttttgcatgtgttagttttttccggtcgtcaagccctgacatctgaaaaatttcaaaatttcaaatttaagaagagacaaacattttataattggaaaaaaacacaagatatcaaaattagacgaaagaaaggaactagtaaacaagaaaaaaccgttttcccgcataaaagaaattc