Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_F57B10.12_b   

sjj_F57B10.12_bSequenceGAATTTCTTTTATGCGGGAAAAC
PCR_productsjj_F57B10.12