Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F57F5.1   

sjj_F57F5.1 RNAi JA:F57F5.1
Simmer:F57F5.1
PCR_productsjj_F57F5.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF57F5.1 Source_evidenceePCR855WS150 Sequence/Annotation Release
Overlaps_Gene F57F5.1 Source_evidenceePCR855WS150 Sequence/Annotation Release
Chunk_score Abs_score792
Max_abs_score792F57F5.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1200559912006622
Overlaps_transcriptF57F5.1 Source_evidenceePCR855WS150 Sequence/Annotation Release
WB_DNA_textsjj_F57F5.11024ccggagctagtagcgaaatgcctaattcttatcagcaatattcgagaaaacgccaaacttcaaaagttatcagtcgcttgaaacgaaaaaactataaaacccctggtaagcgcttgataaattggtcgactgtcgaatttcccaattctccagccaatcgaaaaatggtaaggcttaattttcctgaagtttaacttcagtttcaaaaacttttcaatttcagaaaactgcaattgctgctcttcttgtcggccttgtcgccgtcaacgcctacaatgttgaggttaagcacggagatgccattccagttgaagctcaaatgcttcgtggacaggaacttgttgattacgtcaacaaggttcagacttccttcaaggctgagctcggatcatacttcagctcttacccagataccattaagaagcaattgatgggagctaagatggtcgagatcccagaagagtacagagttagtaaatttgaatattttaaagattttgaaaaacgcttcccaaaaaatacagatttctttcaaactaatttatcctaatgaaattgtttccaggttttcgagatgactcatccagaagtcgaggatgctgctgttccagactcattcgattcccgtaccgcatggccaaactgcccatccatctccaagatccgtgatcaatcatcctgtggatcgtgctgggctgtctctgctgctgaaactatttctgatcgtatttgcattgcgtcaaatgccaaaactatcctttccatctctgctgacgatatcaatgcttgctgtggaatggtctgtggaaatggatgcaatggtggatatccaattgaagcctggcgtcactatgttaagaagggatacgttaccggaggatcttatcaagataagactggatgcaagccatacccatatccaccatgtgaacatcacgtcaatggaactcattacaagccatgcccatccaacatgtacccaactgacaaatgcgaacgctcttgccaagctggatatgctctc