Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F58A4.3   

sjj_F58A4.3 RNAi JA:F58A4.3
Simmer:F58A4.3
PCR_productsjj_F58A4.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF58A4.3 Source_evidenceePCR766WS150 Sequence/Annotation Release
Overlaps_Gene F58A4.3 Source_evidenceePCR779WS150 Sequence/Annotation Release
Chunk_score Abs_score695
Max_abs_score695F58A4.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII96154339616513
Overlaps_transcriptF58A4.3 Source_evidenceePCR779WS150 Sequence/Annotation Release
WB_DNA_textsjj_F58A4.31081tttcgaccaaaaatgcttccgccgcttcttgaagagcactgatggcgtcagaacgaatacggcagtcggcgccaaatggagtggaagtctgcataatttcgcggacgaggcgtgcgaacggagcctgaaatttggaattgttttaatatagtttaaataaagtaaaaattgtataccttttgaatcagaaggtcttcagttttttggtacttgcggatctcttccaatgccttctggcccggtctataacgtctcgttttggtgactctgttccttccggctctcatccgcacgcgatcggagctcgatgggccagttctattaccacgatcggggttcgatgggccagctctatttccatcgccatttgttccatccatagaatagttttcttcgtcggagctatcgtgtcgacggtatgagggcatatgatgacggccgtgggagtaatcgacaagattcgtggaatttctgccgacctgaaataaattttatgttgtttgaaatcatacaaaattgaaactaaccgtgaaatccatagacgaagctcttctccgagcttgctcttttcgcgcgtgatattcgtcttcggcttgcttcaacttcaagacatattgattccgtttgcctgtgaccaatcgaattttgtggatgtgcgcttcagtgtagtcgttggctgcatcatcctcaagctccttcttatactggttcagaatgtcgatcaaatcgttgacacctgcggcgcttgtgttgaatcccggcactgaagtgactctgaaacagcagacattaatttgtagcacgaaaacaaaaatcatcacttacctttgcatgtcatgtttgagacgttgcatgatccttgtgacgctctcattttgctcggcgatttcctcaataattggggtgtcatcggccattgttcgaagattatcctgataaaatataaaatttagaaaactgaagctaaattaagacgatttgtttgaaggttaaaaaggaattaaagaagcaataaatgcgaacgcagtttaaataagtaacgattggcggcgagagacgcagggaaatacgcagacgacat