Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F58A4.8   

sjj_F58A4.8 RNAi JA:F58A4.8
PF:GL1_2G10
PCR_productsjj_F58A4.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F58A4.8 Source_evidenceePCR923WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII96275339629043
Overlaps_transcript F58A4.8.2 Source_evidenceePCR923WS150 Sequence/Annotation Release
F58A4.8.1 Source_evidenceePCR923WS150 Sequence/Annotation Release
WB_DNA_textsjj_F58A4.81511aacccgagaagcagttgaaaccatcattgaagttggttttaacaagaagcgagtgacgtcagcgactgaagtttttcgggtaaagttctcatttggatcgacaacaggagagatagctgcaaaaaacaaaataaatagataaaataacatatttcggaataaaaacaaaccggattgaataaagtgcattggtggaaacggagccaaatccaaataccgaattgatgggcacattgcagagttgaatcgatatggagcagtggaagtgctcatgattcgggcgacaagagaattgatatgatcaaatgttggtgtatctgttttgaattttccagccgcaagacggtgcagtgcagcattatcgaggacaacaacatgatctgaaaactatttatttgaaattccttttttttattattactcagatacaaaaattgagacggtacccggtctttttcacttaatgcgaatatatgtgagccttttaagggtactgtaatttcaaacgttcgttgttgcggaattttcatagatttttcgataaatcattgtcatttcgtttttaatttattaacttaccaggattctcaataagtctttgcatagaaagtacccagttatatggatgaacaacaacgtcagtactggtgtcactatttgcaaaaacactgtaagtttgaataactttcttcggaaatgcttcgcgaagcctttcgagcaagagagatcccgttccagatccagttcctccagaaacactatgagtaaatagaattccatccaaattgttcgtattttcagcctctcgaatgatgatatccattatcttctcttgaacttctcttaaatattatttatcattgattttcaattaaagaaatacaactcactgtccttgacaatatccacttgcccaattatttccagcaccacctccgtgatcggacatgaatatattgtccgtattgaaaagattcgaaaagtttggagactgcatcattccgttgattacacgaggttctagatcgactagaactgctcttggcacataatgatcgtcatcagcctggtagaacaatagatctttcttatcattcatatcgtcttcgtgagttgtttgtccacgtctgaaaacgaaaaaaattgttatatttatcaaaattatgaggctgaattatgaccttgaataaattgcgtcttaaattatttaacttagcaaaaatgtttgtttcatctcaaacaaaagtaaaataattcatattttgttttcaatcatgtcgattcacgagaacaattcacaattgcagcatttcagtattgaaatataaaaattgcaatagttttcacatttcggactgtggtatatcgaattttgcctaattgaaattgtcggtgcctcaaatttattccctactcattgattccatgttcgtcgaccatcgatttccagaaggcttgagcaagctgatttccgcactgtccaacgtggacagtcatcaaggcacccgtac