Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F58A6.8   

sjj_F58A6.8RNAiJA:F58A6.8
PCR_productsjj_F58A6.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F58A6.11 Source_evidenceePCR234WS150 Sequence/Annotation Release
F58A6.8 Source_evidenceePCR384WS150 Sequence/Annotation Release
Overlaps_Gene (33)
Overlaps_transcript F58A6.11 Source_evidenceePCR234WS150 Sequence/Annotation Release
F58A6.8 Source_evidenceePCR458WS150 Sequence/Annotation Release
WB_DNA_textsjj_F58A6.81150ggcattcaaaatcagaaaagttgaactaaggccttcttactctcaaggcaaacattttttttcaaattgatgaacaaaaacacataatcagagaacgatttattagaggattcagaggagatggtcttatgggttgtactcaattgggaggttcttgcgacgaaccataccgtctccttggaaccattcacggcggaattgcttggcagctccatccggggtattggtccactcaacggtgatacggtcgttgtttgtatcctcctgaccgaaggcaaaggcatcacaggaaactgccagaagaactgcctcctttgggtccaaaactccacatggtggatcaactccaagtctcttcatattggtggtcttgataccgtatccaatacggcgagccgaggagttaatcactttgatgtgatacgtgtgcttgtcgtcgtatggtgcattgaagacgatcttcgtacccggctgggtctggatgtctcctggtgggacggattgggccatggcgacttctttgtagagtgtgaaaactcacagtgaagattatggcaaaacctgctcaatttatagcaaatttctctcttatctctgtcctagatctatagcaaacaacgtgaggtcatttcacgtacaaatagctagggcttcaatcagtattgatttctcaattatttttttgtggaaaattatagcagttttacagtatgctgggccgagttgaaaatgaatattgatggtgatgataaaaaatttttaaagtagtttcaggatctttcgttcaaaatgagtaactttcaagcaatgcaacttacaaaagcgaaacataacatgacagcatataataaaatactaataaaataggcaattagaagagtcttcaaatttccatgaaaataaagttgaaatagtcttttaaacatgaaataaatcaatcctggaacggcaaaacttgaaacagaaaatgtataaaattgagaaaaccgataaactgtgttgaaagttatttgaaagccgagatcgcattttgtttgattaattcccgccatttcagaaatagtaaacgtatgcaagtataaaaaatatgattatttcaaagtttctagtcgagtgagcacctctttctgggtgaaaactaatatgctgc