Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F58F12.1   

sjj_F58F12.1 RNAi JA:F58F12.1
Simmer:F58F12.1
PCR_productsjj_F58F12.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F58F12.1 Source_evidenceePCR599WS150 Sequence/Annotation Release
Chunk_score Abs_score515
Max_abs_score515F58F12.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII63834896384500
Overlaps_transcript F58F12.1.1 Source_evidenceePCR599WS150 Sequence/Annotation Release
F58F12.1.2 Source_evidenceePCR594WS150 Sequence/Annotation Release
WB_DNA_textsjj_F58F12.11012ttgtttgttccccaaatacaatctattcctccgattttttcatttataattcttaatacacatattgaccttctaaaaatcaatcaaacaatgttatcatttcagagggtaagatgttggctcgtactatccaaagattctcggttgttgccaagcgcggatacgccgctgccgctccagctgccaacgccaacccagaggagcttcgtctcactttcgcctccccagacaccgtgagtaaatattatttgaaaacattatttgaaaatcaatttacaggctgtcttcagcaatgctgtcgtcaagcaggttgatgtgccaactttggccggtatggttggtgttcttgccaatcacgtcccaaccattggagttttgaaaccaggagttgtctctgtcaccacaaatgaaggtttattttgcaaaaataaattgtattatcaccaaagaatttttcaggaacagttcaacgccttttcgtctcttcgggaaccctctccgtgaacatcgatggatcatgccaagttcttgctgaggaggtcctgaaagttgaagaaattgatgagtctgctgcccgcgccgagcttgatgctgcccaaagagcctccggagaaggaagcgaggttgctcgtgctgaagctcaaattcgcgctgaagtaagtgttcgaaaaagttttaaaaaccaaaaaaaaatacaagaaacgaatatcgtttggtttcagcaaagttaagcatttcgtaatatttttattatcaaaatgattctgtgcttcgatactaaaactgagaccaggacataaagttgagggtcataaaagtagttctctgaaatgaatatgtctttaagttttgtttcaaaacaagggaatttttcaggttgctgaagcattgatcaaggccgccacgaaccagcaataaggagtatgttgagagtagaccctttaactttggtaaattcctttttaatttgatcctaggcacatcgtcaatttctctcgatgctgcttatagg