Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F58F9.1   

sjj_F58F9.1 RNAi (5)
PCR_productsjj_F58F9.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F58F9.1 Source_evidenceePCR782WS150 Sequence/Annotation Release
F19G12.2 Source_evidenceePCR776WS150 Sequence/Annotation Release
Overlaps_Gene F58F9.1 Source_evidenceePCR782WS150 Sequence/Annotation Release
Chunk_score Abs_score717
Specificity_index0.494
Rel_score0.977
Map_statusBest_ePCRIV62504666251612
F19G12.2 Source_evidenceePCR776WS150 Sequence/Annotation Release
Chunk_score Abs_score734
Max_abs_score734F19G12.2
Specificity_index0.506
Rel_score1
Map_statusTop85_percentile_ePCRX14283251429449
Overlaps_transcript F58F9.1 Source_evidenceePCR782WS150 Sequence/Annotation Release
F19G12.2 Source_evidenceePCR776WS150 Sequence/Annotation Release
WB_DNA_text sjj_F58F9.1_11125ttgacttgatgaatcagccgcgagtgctcttgaacggttgtaatgtgaaacttacagtttacccaaatgatagtaaatttttgattgaggcttacaatcgcgacaacaacacagagtttcagttcaaaataaccgacgtttacgctctggttaacgaattcgatcttgccgacggcctatctaatgctctagagagctccattattgagcacaaaataatccaatatcctctaatatcttcacaggtgcgcagtttctatatagagtctggacgtcttgacgcgccggctaacacactcttcacaagcaagatgccccgtcgaattttcattggtcttgttgattctgacgcgtacaatggctcttatgataaatcaccattcaatttcaaaccacatggtatatctgatatacatgttgattattgtggaatgacactccccggccgcccttttgccttagattttgacagaaacaagtttatggaggcatacattcaacttcaagaaaccctcggtcactcgcgaagcaattccacatgtaattctattagcacccaaatgtttaaagaaggcggatatacgatttttggttttgaattgagtcccgttgctcaggacacttcactatttgagttggtgcgacagacaaacgtcagcattcgtttaaatttccgagaaaaggttcccgtcggcggtctttactgcatagtatatgcagaatttgaccaaattttctcacttgattttatgagaaatccgattgtcgacactatagtttaattataattagattcttcgtatttggcatgttttcctcattaccgttattgtcgcgttccgtaccattcaggcgtgaaaacatgttttggctttcagtaccaatcaagcgtgaatataaaacgtgctataagttgttatggagctcatcacacacacacacacacacacacacacaggcagaaacaaacaagaccactacctcgaagtttaaaaaagagtgaatacacgaaaagggttgcatttctggaaacatacacactttcttgtatagcctgcctcctccacttttcagttgtcttttcgaatagccacaattttcccttatgtgcaccgcatttacaaa
sjj_F58F9.1_21147ttgacttgatgaatcagccgcgagtgctcttgaacggttgtaatgtgaaacttacagtttacccaaatgatagtaaatttttgattgaggtttacaatcgcgacaacaacacagagtttcagttcaaaataaccgacgtttacgctctggttaacgaattcgatcttgccgacggtctatctaatgctctagagagctccattattgagcacaaaataatccaatatcctctaatatcttcacaggtgcgcagtttctatatagagtctggacgtcttgacgcgccggctaacacactcttcacaagcaagatgccccgtcgaattttcattggtcttgttgattctgacgcgtacaatggctcttatgataaatcaccattcaatttcaaaccacatggtatatctgatatacatgttgattattgtggaatgacactccccggccgcccttttgccttagattttgacagaaacaagtttatggaggcatacattcaacttcaagaaaccctcggtcactcgcgaagcaattccacatgtaattctattagcacccaaatgtttaaagaaggcggatatacgatttttggttttgaattgagtcccgttgctcaggacacttcactatttgagttggtgcgacagacaaacgtcagcattcgtttaaatttccgagaaaaggttcccgtcggcggtctttactgcatagtatatgcagaatttgaccaaattttctcacttgattttatgagaaatccgattgtcgacactatagtttaattataattagattcttcgtatttggcatgttttcctcattaccgttattgttgcgttccgtaccattcaggcgtgaaaagatgttttggctttcagtaccaatcaagcgtgaatataaaacgtgctataagttgttatggagctcatcacacacacacacacacacacacacacacacacacacacacacacacacaggcagaaacaaacaagaccactacctcgaagtttaaaaaagagtgcatacacgaaaagggttgcatttctggaaacatacacactttcttgtatagcctgcctcctccacttttcagttgtcttttcgaatagccacaattttcccttatgtgcaccgcatttacaaa