Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F58H1.2   

sjj_F58H1.2RNAiJA:F58H1.2
PCR_productsjj_F58H1.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF58H1.2 Source_evidenceePCR538WS150 Sequence/Annotation Release
Overlaps_Gene F58H1.2 Source_evidenceePCR538WS150 Sequence/Annotation Release
Chunk_score Abs_score454
Max_abs_score454F58H1.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1193153111932432
Overlaps_transcriptF58H1.2 Source_evidenceePCR538WS150 Sequence/Annotation Release
WB_DNA_textsjj_F58H1.2902aacaaaagatttggaggaaaagcctagattttgaagggatgagaagtgagagagtgaagaggagtgaagaacggatgcatctcttgacccaaatcgccttatttcaatcacttgtttatcatgtcaacggctgatttgtatcatttcgcgcttctacgcaggaatggtgatgttctatgcagctgcagttattctagctgtatccgcagtttcaggtgagttactgaaatattttgtttcataaactgcactaggatgcgtacaaaatgataaatattatttaatcccttatttcagccgacccatttatttataacgtctactcatcttcgggatctcgttcaggatatggaaatccttatgaacgtgatgaagtctatattcgtagacccggaatgagcggaagttcattctattctggttcgggtaacccaatgatgtcgtccatgggatcaatgagttctatgggaggatttcaaggattacagggaatgcaaggaattcagagtatccataacatgcaaggaatgcaacagatgccgtatggactttctagcagtatgatgggaatgggtgagatttaataccttgtgtggaaatcacacattatcctaataaaatcggaaatttcaaaacttcagatacgtatggatctaacatgtataagcctcgtttcgctgcatctgatatgatgatgggaggtggtcaaccattactactcaatggatatccaatgtacccaagtgagtcaacagatatcaattcatttttattaattcattaatgatctttagaaacttctggatacccaatggtgattccactggccatgggatcctatggatcttctcctacagtataccagggaccaactgtctctcgtcttccattcagagctactc