Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_F59B10.1_f   

sjj_F59B10.1_fSequenceATGTGGTTTACGATCGGCTC
Length20
In_sequenceSUPERLINK_CB_II
PCR_productsjj_F59B10.1