Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F59C6.4   

sjj_F59C6.4 RNAi JA:F59C6.4
Simmer:F59C6.4:Screen_A
Simmer:F59C6.4:Screen_B
PCR_productsjj_F59C6.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF59C6.4 Source_evidenceePCR681WS150 Sequence/Annotation Release
Overlaps_Gene F59C6.4 Source_evidenceePCR685WS150 Sequence/Annotation Release
Chunk_score Abs_score622
Max_abs_score622F59C6.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1051815710519288
Overlaps_transcriptF59C6.4 Source_evidenceePCR685WS150 Sequence/Annotation Release
WB_DNA_textsjj_F59C6.41132tagtttttccgtttattttgcgaaatattatcactttttgattaattttattgcaaaaatttacaattttcagttaatatactcattgaaaacactttattaacgtagcttattacgttattcctcctgcggtatttaaatttggtttttctattcgccactactttttaaaacgttattttgttcatcattgagtattcaattttcagaaatgaccgtatatctccctggcgacgttatcaatgaaccttcttcaagcgattcctcaatcattggctacggaattagtgtacgtggccaaacgagaattgccactcaacctggagctttccacaacgatgatggaaaagtctggttaaatgttcacagcaaaaggtaagaatgatcacgaacaacatttaaaatcacaatttttcttaaattcagatatataccacaggaaggagaccgagtaatcgctattgtcacttcaaaaactggtgatttctttcgtttggacataggaactgccgaatacgccatgatcaactttactaacttcgaaggtgctactaaaaggaataggccgaatctaaaaactggagatattatttatgcaacagttttcgacacaactccaagaactgaagcagagcttacctgtgtggatgacgagaaacgagcacgtggaatgggacagctaaatggaggattcatgttcaaagttagacacgaaatttactatttattgtaaaatttaaaaattattataggtctccttgaatcattgtcgtcgactaatcaacccatcttgcaaaattcttcaaactgttggcaagttcttcaaattcgaaatcactgttggaatgaacggaagaatctggattagtgcttcgacttctgatgatattatcaagattcacgatattatcaataaatcagagtttatcactgacgaagatgagcttatcaccctggttcagaataattacacacgatctgtcagtgattaagaatctttatctcaatttttaatttttcagtgtaattcctgctattgttgatttttttttccttttgttgttgaactttttaaaaatttaatttatcgtcttgttctatgtaatatttcaattttcaacgtttcttcgtt