Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F59C6.5   

sjj_F59C6.5 RNAi JA:F59C6.5
Simmer:F59C6.5:Screen_A
Simmer:F59C6.5:Screen_B
PCR_productsjj_F59C6.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F59C6.5 Source_evidenceePCR714WS150 Sequence/Annotation Release
Chunk_score Abs_score653
Max_abs_score653F59C6.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1051935410520514
Overlaps_transcript F59C6.5.1 Source_evidenceePCR714WS150 Sequence/Annotation Release
F59C6.5.2 Source_evidenceePCR714WS150 Sequence/Annotation Release
WB_DNA_textsjj_F59C6.51161gaaggcttagtggagcaacgtcaagctgacgataaagcatcttgggatgcttactggaaagttcgtgatatcgattcacgaggatccatctacccacgattccgttattatgcccataaggctttcgacgccccagcaacttggttcagaggtaatttttaaaattctcaagttggagaatcatttaaagaagaagcagctttgaaattagatttaaaaccatttacaaaatgtaagaattgacagaaaacaaatttcgttcaagtttatttactttcaccatttgttttaattccaagtaattgatactgtctacggttttatccagattcaaaaaatttgggaacttgtggtgcaagtaaaggttaatttctaattcccatatcattgctgtaaattataattttaaactagaaaaaaaccaaagttattcgactacctcaagctgatgtacagttagtagttgcagttccacataataaatcaactaggcaaaacaatccattttaatctattctactaactcgtcagcttttcagagactattgtgcaaccactcaacaacaagaaccgtctaccctactatcaccgtcaacttacacgtgttccggaaatcgacgaatgcggagtgaacgacaaggcctgcttctacgaagccaatgagcagtaccgtcttgataaaatggtcgatggatttattctgcaaaccctccgccaacgtgttgatcggtgtatgctttacaacaatcctgatcattcaccatgtgccaaggttattgaggatatggaagagaatgagttgaatttcttcatgaaatacggagagttgggaggagaatccgatgttcgtgatgcttatatgaagcagaagcatcgaatgatctgggaacgacgtcatccagagattatggatgagcgtgcagctaagcttgctgatcataaagcacgacttgctaatggagagtttgactattcattctggaagaagggaatgttctatcaagacaagaagaactatgagccaccatatgagttccaaatgagcaagtcagcactcgagggtgacaagccattgtccaaggattgggaatactacaagaaggtaaatattctttcaagatttaattttaaaaaagaagctacgagagaatcctggatcga