Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F59C6.8   

sjj_F59C6.8RNAiJA:F59C6.8
PCR_productsjj_F59C6.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF59C6.8 Source_evidenceePCR1138WS150 Sequence/Annotation Release
Overlaps_Gene F59C6.8 Source_evidenceePCR1138WS150 Sequence/Annotation Release
Chunk_score Abs_score991
Max_abs_score991F59C6.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1051044010512732
Overlaps_transcriptF59C6.8 Source_evidenceePCR1138WS150 Sequence/Annotation Release
WB_DNA_textsjj_F59C6.82293agtccgggattaagttgaaagacttcccttgtaaagaaaatacctatccaagttgcagttaactaagctttcaaatagattcgaaaatgtctgaaaattcatgaagtaaacgatgtacccactcagtatttgctcaaaatccccccaatatttttttcataggattaacaatattcgatcgtcaacacaatcacattctccatgactacgtggcacgaaacgacgatattgtggttttatcgacgacatattatgagaattcaaaaagttttccaccaaatacagctgtaatattattcaattctgttcaagtatttcatttgaaatactcaaatttaaacgtggtcgccgagacgatgcaaggaaacgtggaagttcagttcaaaattcaaccagtaataaatacaattccatttttctgtaaatgggtaccctatctagctgttgggcaagtacccgaagatcatgttttattgaaattatcaactaataagattgatggaatggaggttagttgatgttaagaaaaacgaataactttacccgggacttttcctgaaaagttaccttctaaaagcgtaatgatttagaggtcataaaaagtctcaattgttcaaccttactaggaagaatttcaagaaatgactcaaaaagccgaagcattacagccacaccatcctaaatgaaaatcaataaaaaaacttcagttatccctccgaactccatacgaaacaccacgaaaagttgttgcatgtttctctccgttatttttgaatgaaagatggcagcttcttcttgcaactgttgaggtaacttttcatcaggaactccacgatcattcaatatttcagatatactctcattatggtgcattcatgcatttctatgtgagatctatcattacggatttgttcaagttgattaaggataacaaaaatgtatgcaacctgttcccagaaatgccgaaaaaaattgttcaaaaattattatttagaccagaatttctccttggtctgctataagaattggagaatctcgtgccgcgtctccgatgttcgatccaaacactgaacttgagttccggaatcaagcttcagctatgactgattgtctactgcaatataaggaagccgcagagtttattgtatttccggatccagatgacatccttgttccagtgttgggcaaaaattattatgaagagtttacgcaggtgggatattagtaaaatagtaaaatatttgatacaaaatttctgaatgagttctgaatgaaacttctgaatgaaaatgtcatttgaaaagacaccactcaagtagaaccatacaatttttattgaattatttttttggaataagctatcaaggtgattatcttacacataaaatctctgaaaatcattgaaagttcaaagaagctaaatttggagagactctacaaaactcaaaagtggtagaataatgagctgaaatcccttcaagttcaaaaaattccgggaaggtttagtattgccgcttaacttttttccatgagatgcagttctaattatgaattctggcaatatctggaccatgtaagccgaaaatcaaattgaccataaaataacttcatgtagaacatcagtgtcagaacctatgagatatattttctaatttccaatcgacacgcggaacttcttcctgtcacttgaatatttctaatcgtagatttaaatcttgcgaaaaatgtgttgaagatgttggatgtctccaaattgtcccaaaataccatttcaggcgtttaaaatgttccccacggccggtgcggtcgtttataatatgacacagacttccattgaatcttgtgagttgatagaaaaaagaaaaattgaatcaactaaaaacatacgtttcagcaatgacaccagcgttgtattcacctatttcaatgctggcatcgatgaaattcaaagtgagttcatggaaataaaaaccacagttttcacaaaaattctgaattttatggaatcactagtttaatcaattttcagggagaacaaaaatggggaaagctggtagttcgaccagaacgagtcgatagtacatggatccatagatcgtatgcaattaaagaaggatttgagcaaaaagtgatgccagttgatgtcaatgcattttatcatttgagaatatggaaatttcctgaagttccaactttcaatagatcaagtgagcttctgtgaagagttccatgtcatctggtagaatttttcagaaatttccaatcctccgtttttcgacccttatcacttgaa